Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sorghum bicolor (sorghum) sbi-miR166c URS00005C8AFA_4558

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Arabidopsis thaliana (thale cress) AGO1_0306
  2. Citrus sinensis csi-miR166c-3p
  3. Cucumis melo (muskmelon) cme-miR166g
  4. Cynara cardunculus var. scolymus cca-miR166f
  5. Glycine max (soybean) gma-miR166p
  6. Prunus persica microRNA miRNA_264
  7. Theobroma cacao tcc-miR166b
  8. Zea mays (maize) zma-miR166d-3p
Publications