Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR166d-3p URS00005C8AFA_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-miR166c-3p: Zma-mir166c-3p, a member of the miR166 family, is down-regulated in the A3-A9 dwarf mutant and targets various genes including homeobox-leucine zipper protein, peroxidase, ABA responsive element binding factor, and ribonucleoside-diphosphate reductase subunit M2 [PMC4628322]. In a study investigating non-infected and infected treatments at different stages, 15 differentially expressed miRNAs and their target genes were screened for RT-PCR verification, including zma-mir166c-3p [PMC9222952]. XPB2, a target gene, is predicted to be targeted by the miR166 family, which includes zma-mir166c-3p [PMC8472271]. The expression levels of XPB2 were authenticated for six miRNAs, including zma-mir166c-3p [PMC8472271]. Additionally, various other target genes were identified for different miRNAs, such as RPA1B for four miRNAs, AlkA for three miRNAs, MSH3 for two miRNAs, MSH-like for two miRNAs, REX1 for two miRNAs, as well as RAD23, XPC, Hhh-GPD, MRE11, and RAD51B each targeted by a specific miRNA [PMC8472271]. The expression relationships between miRNAs and their target genes were observed as expected [PMC8472271].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Arabidopsis thaliana (thale cress) AGO1_0306
  2. Citrus sinensis csi-miR166c-3p
  3. Cucumis melo (muskmelon) cme-miR166g
  4. Cynara cardunculus var. scolymus cca-miR166f
  5. Glycine max (soybean) gma-miR166p
  6. Prunus persica microRNA miRNA_264
  7. Sorghum bicolor sbi-miR166c
  8. Theobroma cacao tcc-miR166b
Publications