Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-191-5p URS00005C2E31_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 8 databases (IntAct, RefSeq, LncBase, PirBase, miRBase, MirGeneDB, TarBase, ENA). Described in 25 papers. Mus musculus (house mouse) mmu-miR-191-5p sequence is a product of miR-191-5p, miR-191, Mir191, mmu-miR-191, mmu-miR-191-5p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610011H20Rik, 0610039K22Rik, 1010001J06Rik, 107kDa, 1110013E22Rik, 1110020D10Rik, 1110029L17Rik, 1110049L02Rik, 1110069N17Rik, 1300003O07Rik.

Interactions 1

According to IntAct, Mus musculus (house mouse) mmu-miR-191-5p interacts with:

IntAct ID Participant Synonyms
EBI-16752177 intact:EBI-16752162 EBI-16752162 ENSMUST00000053317.11 mrna_bdnf-1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAACGGAAUCCCAAAAGCAGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Anolis carolinensis (green anole) aca-miR-191-5p
    2. Bos taurus (cattle) bta-miR-191
    3. Callithrix jacchus cja-miR-191
    4. Canis lupus familiaris (dog) Cfa-Mir-191_5p (mature (guide))
    5. Cavia porcellus cpo-miR-191-5p
    6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-191_5p (mature (guide))
    7. Cricetulus griseus (Chinese hamster) cgr-miR-191-5p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-191-5p
    9. Daubentonia madagascariensis (aye-aye) dma-miR-191
    10. Echinops telfairi Ete-Mir-191_5p (mature (guide))
    11. Equus caballus eca-miR-191a
    12. Gallus gallus (chicken) gga-miR-191-5p
    13. Homo sapiens (human) hsa-miR-191-5p
    14. Macaca mulatta (Rhesus monkey) mml-miR-191-5p
    15. Microcebus murinus (gray mouse lemur) mmr-miR-191
    16. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-191
    17. Ophiophagus hannah (king cobra) oha-miR-191-5p
    18. Ornithorhynchus anatinus (platypus) Oan-Mir-191_5p (mature (guide))
    19. Oryctolagus cuniculus (rabbit) ocu-miR-191-5p
    20. Otolemur garnettii oga-miR-191
    21. Pan paniscus ppa-miR-191
    22. Pan troglodytes ptr-miR-191
    23. Papio hamadryas pha-miR-191
    24. Pongo pygmaeus (Bornean orangutan) ppy-miR-191
    25. Python bivittatus (Burmese python) pbv-miR-191-5p
    26. Rattus norvegicus rno-miR-191a-5p
    27. Saimiri boliviensis boliviensis sbo-miR-191
    28. Sus scrofa ssc-miR-191
    29. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-191_5p (mature (guide))