Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-191 URS00005C2E31_39432

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAACGGAAUCCCAAAAGCAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-191_5p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-191-5p
  3. Bos taurus bta-miR-191
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-191
  5. Canis lupus familiaris (dog) Cfa-Mir-191_5p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-191-5p
  7. Chrysemys picta bellii Cpi-Mir-191_5p (mature (guide))
  8. Cricetulus griseus cgr-miR-191-5p
  9. Dasypus novemcinctus dno-miR-191-5p
  10. Daubentonia madagascariensis (aye-aye) dma-miR-191
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-191_5p (mature (guide))
  12. Equus caballus (horse) eca-miR-191a
  13. Gallus gallus (chicken) gga-miR-191-5p
  14. Gekko japonicus Gja-Mir-191_5p (mature (guide))
  15. Homo sapiens hsa-miR-191-5p
  16. Macaca mulatta mml-miR-191-5p
  17. Microcaecilia unicolor Mun-Mir-191_5p (mature (guide))
  18. Microcebus murinus (gray mouse lemur) mmr-miR-191
  19. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-191_5p (mature (guide))
  20. Mus musculus (house mouse) mmu-miR-191-5p
  21. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-191
  22. Ophiophagus hannah (king cobra) oha-miR-191-5p
  23. Ornithorhynchus anatinus Oan-Mir-191_5p (mature (guide))
  24. Oryctolagus cuniculus (rabbit) ocu-miR-191-5p
  25. Otolemur garnettii (small-eared galago) oga-miR-191
  26. Pan paniscus (pygmy chimpanzee) ppa-miR-191
  27. Pan troglodytes (chimpanzee) ptr-miR-191
  28. Papio hamadryas pha-miR-191
  29. Pongo pygmaeus ppy-miR-191
  30. Python bivittatus (Burmese python) pbv-miR-191-5p
  31. Rattus norvegicus rno-miR-191a-5p
  32. Sarcophilus harrisii Sha-Mir-191_5p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-191_5p (mature (guide))
  34. Sus scrofa ssc-miR-191
  35. Xenopus laevis Xla-Mir-191-P2_5p (mature (guide))
  36. Xenopus tropicalis Xtr-Mir-191_5p (mature (guide))