Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-191 URS00005C2E31_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-191: Ssc-mir-191 is a microRNA that has been identified in various studies as one of the most significantly detected miRNAs in different contexts, such as high-fat diet groups [PMC8180175], different porcine tissues and breeds [PMC3438195], and the anterior pituitary [PMC4489742]. It has also been found to be highly expressed in libraries of miRNAs from different sources, such as the F4 library [PMC3901342], F3 library [PMC3901342], DWZ and Yorkshire libraries [PMC9996253]. Ssc-mir-191 has been included in panels of miRNAs used as reference genes in studies involving porcine tissues and breeds [PMC3438195]. It has also been investigated in relation to colorectal cancer development, with low and unchanged expression observed in certain studies [PMC5707088]. Ssc-mir-191 has been found to have binding sites with circ_1268 [PMC9219244]. Additionally, it is one of the most abundant miRNAs identified across datasets related to sperm physiology and regulation processes [PMC9961432]. It is also among the most abundant miRNAs found in liver samples across various studies [PMC7724732] and has been associated with liver-related functions such as liver development, hepatocyte differentiation, and liver disease progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAACGGAAUCCCAAAAGCAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-191_5p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-191-5p
  3. Bos taurus bta-miR-191
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-191
  5. Canis lupus familiaris (dog) Cfa-Mir-191_5p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-191-5p
  7. Chrysemys picta bellii Cpi-Mir-191_5p (mature (guide))
  8. Cricetulus griseus cgr-miR-191-5p
  9. Dasypus novemcinctus dno-miR-191-5p
  10. Daubentonia madagascariensis (aye-aye) dma-miR-191
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-191_5p (mature (guide))
  12. Equus caballus (horse) eca-miR-191a
  13. Gallus gallus (chicken) gga-miR-191-5p
  14. Gekko japonicus Gja-Mir-191_5p (mature (guide))
  15. Homo sapiens hsa-miR-191-5p
  16. Macaca mulatta mml-miR-191-5p
  17. Microcaecilia unicolor Mun-Mir-191_5p (mature (guide))
  18. Microcebus murinus (gray mouse lemur) mmr-miR-191
  19. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-191_5p (mature (guide))
  20. Mus musculus (house mouse) mmu-miR-191-5p
  21. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-191
  22. Ophiophagus hannah (king cobra) oha-miR-191-5p
  23. Ornithorhynchus anatinus Oan-Mir-191_5p (mature (guide))
  24. Oryctolagus cuniculus (rabbit) ocu-miR-191-5p
  25. Otolemur garnettii (small-eared galago) oga-miR-191
  26. Pan paniscus (pygmy chimpanzee) ppa-miR-191
  27. Pan troglodytes (chimpanzee) ptr-miR-191
  28. Papio hamadryas pha-miR-191
  29. Pongo pygmaeus ppy-miR-191
  30. Python bivittatus (Burmese python) pbv-miR-191-5p
  31. Rattus norvegicus rno-miR-191a-5p
  32. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-191
  33. Sarcophilus harrisii Sha-Mir-191_5p (mature (guide))
  34. Sphenodon punctatus Spt-Mir-191_5p (mature (guide))
  35. Xenopus laevis Xla-Mir-191-P2_5p (mature (guide))
  36. Xenopus tropicalis Xtr-Mir-191_5p (mature (guide))
Publications