Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-23b-5p URS00005B5CA1_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUUCCUGGCAUGCUGAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Alligator mississippiensis ami-miR-23b-5p
  2. Anolis carolinensis aca-miR-23b-5p
  3. Bos taurus bta-miR-23b-5p
  4. Cavia porcellus cpo-miR-23b-5p
  5. Dasypus novemcinctus dno-miR-23b-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-23b-5p
  7. Monodelphis domestica mdo-miR-23b-5p
  8. Mus musculus (house mouse) mmu-miR-23b-5p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-23b-5p
  10. Pteropus alecto (black flying fox) pal-miR-23b-5p
  11. Python bivittatus (Burmese python) pbv-miR-23b-5p
  12. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4736145
Publications