Monodelphis domestica (gray short-tailed opossum) mdo-miR-23b-5p URS00005B5CA1_13616

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 12 other species
• 125 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GGGUUCCUGGCAUGCUGAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Alligator mississippiensis ami-miR-23b-5p
2. Anolis carolinensis aca-miR-23b-5p
3. Bos taurus bta-miR-23b-5p
4. Cavia porcellus cpo-miR-23b-5p
5. Dasypus novemcinctus dno-miR-23b-5p
6. Macaca mulatta (Rhesus monkey) mml-miR-23b-5p
7. Mus musculus (house mouse) mmu-miR-23b-5p
8. Oryctolagus cuniculus (rabbit) ocu-miR-23b-5p
9. Pteropus alecto (black flying fox) pal-miR-23b-5p
10. Python bivittatus (Burmese python) pbv-miR-23b-5p
11. Rattus norvegicus rno-miR-23b-5p
12. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4736145

Publications Download

• FASTA
• JSON