v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ixodes scapularis (black-legged tick) isc-miR-1 URS00005942EF_6945

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

isc-mir-1: Isc-mir-1 is a microRNA (miRNA) in Ixodes scapularis that was found to be significantly up-regulated in the tick's salivary glands during the early stages of Powassan virus (POWV) infection [PMC6739385]. This up-regulation of isc-mir-1 was observed at a 3-hour feeding time point post-infection, reflecting a potential role in the tick's response to POWV [PMC6739385]. Additionally, isc-mir-1 was among the most abundant miRNAs in POWV-infected salivary gland libraries at this time point, suggesting its importance during early infection [PMC6739385]. Inhibition assays further demonstrated that cells with suppressed isc-mir-1 activity showed significantly higher POWV titers, indicating that isc-mir-1 might be involved in controlling viral replication or influencing virus-tick interactions [PMC6739385]. Contrasting its role during POWV infection, isc-mir-1 was found to be downregulated in Borrelia burgdorferi-infected salivary glands compared to uninfected glands, which could suggest different regulatory roles of this miRNA depending on the pathogen involved [PMC9141961].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAUGUAAAGAAGUAUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Acyrthosiphon pisum api-miR-1
  2. Aedes aegypti (yellow fever mosquito) aae-miR-1
  3. Anopheles gambiae (African malaria mosquito) aga-miR-1
  4. Apis mellifera ame-miR-1-3p
  5. Bactrocera dorsalis bdo-miR-1
  6. Blattella germanica Bge-Mir-1_3p (mature (guide))
  7. Bombyx mori bmo-miR-1a-3p
  8. Centruroides sculpturatus Csc-Mir-1-P18b_3p (mature (guide))
  9. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-1-3p
  10. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-1-3p
  11. Culex quinquefasciatus cqu-miR-1
  12. Daphnia magna Dma-Mir-1_3p (mature (guide))
  13. Daphnia pulex dpu-miR-1
  14. Diachasmimorpha longicaudata Dlo-Mir-1_3p (mature (guide))
  15. Dinoponera quadriceps dqu-miR-1a-3p
  16. Drosophila ananassae dan-miR-1
  17. Drosophila erecta der-miR-1
  18. Drosophila grimshawi dgr-miR-1
  19. Drosophila melanogaster (fruit fly) dme-miR-1-3p
  20. Drosophila mojavensis dmo-miR-1
  21. Drosophila persimilis dpe-miR-1
  22. Drosophila pseudoobscura dps-miR-1
  23. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294467_df_nrg
  24. Drosophila sechellia dse-miR-1
  25. Drosophila simulans dsi-miR-1
  26. Drosophila virilis dvi-miR-1-3p
  27. Drosophila willistoni dwi-miR-1
  28. Drosophila yakuba dya-miR-1
  29. Glossina pallidipes (tsetse fly) Gpa-Mir-1_3p (mature (guide))
  30. Heliconius melpomene hme-miR-1a
  31. Hyalella azteca miR-1
  32. Ixodes ricinus (castor bean tick) iri-miR-1-3p
  33. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-1-P16_3p (mature (guide))
  34. Manduca sexta mse-miR-1a
  35. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50153474
  36. Nasonia giraulti ngi-miR-1
  37. Nasonia vitripennis (jewel wasp) nvi-miR-1
  38. Parasteatoda tepidariorum pte-miR-1-3p
  39. Penaeus japonicus miR-1
  40. Penaeus vannamei partial Lva-miR-1
  41. Polistes canadensis pca-miR-1-3p
  42. Priapulus caudatus Pca-Mir-1_3p (mature (guide))
  43. Tetranychus urticae (two-spotted spider mite) tur-miR-1-3p
  44. Tribolium castaneum tca-miR-1-3p
  45. Triops cancriformis tcf-miR-1
 Relationships

Molecular Relationships

 Publications