Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-27b-3p URS000059311D_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (IntAct, ENA, GeneCards, PSICQUIC, RefSeq, LncBase, miRBase, MalaCards, MirGeneDB, TarBase). Described in 89 papers. Homo sapiens (human) hsa-miR-27b-3p sequence is a product of hsa-miR-27b-3p, miR-27b-3p, hsa-miR-27b, MIR27B, miR-27, miR-27b genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 1A1-3B, 1A6/DRIM, 20D7-FC4, 3D3, 4-1BB-L, 4-1BBL.

Interactions 58

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-27b-3p interacts with:

Interaction id Participant Synonyms
EBI-26352984 intact:EBI-21014881 EBI-21014881 ENST00000256078 mrna_kras
EBI-26352997 intact:EBI-26353007 EBI-26353007 ENST00000392562 mrna_grb2
URS000059311D_9606-0 O43597 O43597
URS000059311D_9606-1 O43597 O43597
URS000059311D_9606-29 O43597 O43597
URS000059311D_9606-28 O43597 O43597
URS000059311D_9606-32 O95477 O95477
URS000059311D_9606-2 O95477 O95477
URS000059311D_9606-31 O95477 O95477
URS000059311D_9606-30 O95477 O95477
URS000059311D_9606-3 O95477 O95477
URS000059311D_9606-4 P01130 P01130
URS000059311D_9606-33 P01130 P01130
URS000059311D_9606-34 P01130 P01130
URS000059311D_9606-35 P06858 P06858
URS000059311D_9606-36 P06858 P06858
URS000059311D_9606-5 P06858 P06858
URS000059311D_9606-6 P06858 P06858
URS000059311D_9606-38 P07996 P07996
URS000059311D_9606-7 P07996 P07996
URS000059311D_9606-8 P07996 P07996
URS000059311D_9606-37 P07996 P07996
URS000059311D_9606-39 P24752 P24752
URS000059311D_9606-9 P24752 P24752
URS000059311D_9606-10 P29353 P29353
URS000059311D_9606-40 P29353 P29353
URS000059311D_9606-11 P33151 P33151
URS000059311D_9606-41 P33151 P33151
URS000059311D_9606-42 P35442 P35442
URS000059311D_9606-12 P35442 P35442
URS000059311D_9606-17 P37231 P37231
URS000059311D_9606-16 P37231 P37231
URS000059311D_9606-15 P37231 P37231
URS000059311D_9606-14 P37231 P37231
URS000059311D_9606-13 P37231 P37231
URS000059311D_9606-43 P37231 P37231
URS000059311D_9606-44 P37231 P37231
URS000059311D_9606-45 P37231 P37231
URS000059311D_9606-46 P37231 P37231
URS000059311D_9606-47 P37231 P37231
URS000059311D_9606-18 P42765 P42765
URS000059311D_9606-19 P54646 P54646
URS000059311D_9606-25 Q07869 Q07869
URS000059311D_9606-48 Q16678 Q16678
URS000059311D_9606-26 Q16678 Q16678
URS000059311D_9606-20 Q5SW96 Q5SW96
URS000059311D_9606-49 Q5SW96 Q5SW96
URS000059311D_9606-50 Q5SW96 Q5SW96
URS000059311D_9606-51 Q8NFY4 Q8NFY4
URS000059311D_9606-21 Q8NFY4 Q8NFY4
URS000059311D_9606-23 Q9H2E6 Q9H2E6
URS000059311D_9606-22 Q9H2E6 Q9H2E6
URS000059311D_9606-52 Q9H2E6 Q9H2E6
URS000059311D_9606-53 Q9H2E6 Q9H2E6
URS000059311D_9606-54 Q9H2E6 Q9H2E6
URS000059311D_9606-27 Q9H2E6 Q9H2E6
URS000059311D_9606-24 Q9H2E6 Q9H2E6
URS000059311D_9606-55 Q9H2E6 Q9H2E6

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCACAGUGGCUAAGUUCUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 77 other species

    1. Alligator mississippiensis Ami-Mir-27-P2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-27-P2_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-27b
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-27b
    5. Canis lupus familiaris (dog) cfa-miR-27b
    6. Capra hircus chi-miR-27b-3p
    7. Cavia porcellus cpo-miR-27b-3p
    8. Cervus elaphus (red deer) cel-miR-27b
    9. Chiloscyllium plagiosum microRNA cpl-miR-27b
    10. Chrysemys picta bellii Cpi-Mir-27-P2_3p (mature (guide))
    11. Chrysemys picta cpi-miR-27b-3p
    12. Columba livia cli-miR-27b-3p
    13. Cricetulus griseus (Chinese hamster) cgr-miR-27b-3p
    14. Danio rerio Dre-Mir-27-P2b_3p (mature (guide))
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-27b-3p
    16. Echinops telfairi Ete-Mir-27-P2_3p (mature (guide))
    17. Equus caballus eca-miR-27b
    18. Gallus gallus (chicken) gga-miR-27b-3p
    19. Gorilla gorilla (western gorilla) ggo-miR-27b
    20. Haplochromis burtoni abu-miR-27b
    21. Ictalurus punctatus ipu-miR-27b
    22. Macaca mulatta mml-miR-27b-3p
    23. Maylandia zebra (zebra mbuna) mze-miR-27b
    24. Microcebus murinus (gray mouse lemur) mmr-miR-27b
    25. Monodelphis domestica (gray short-tailed opossum) mdo-miR-27b-3p
    26. Mus musculus mmu-miR-27b-3p
    27. Neolamprologus brichardi nbr-miR-27b
    28. Oreochromis niloticus (Nile tilapia) oni-miR-27b
    29. Ornithorhynchus anatinus oan-miR-27b-3p
    30. Oryctolagus cuniculus ocu-miR-27b-3p
    31. Ovis aries (sheep) miscellaneous RNA
    32. Pan paniscus ppa-miR-27b
    33. Pan troglodytes (chimpanzee) ptr-miR-27b
    34. Petromyzon marinus (sea lamprey) pma-miR-27b-3p
    35. Pongo pygmaeus ppy-miR-27b
    36. Pteropus alecto (black flying fox) pal-miR-27b-3p
    37. Pundamilia nyererei pny-miR-27b
    38. Python bivittatus pbv-miR-27b-3p
    39. Rattus norvegicus rno-miR-27b-3p
    40. Saimiri boliviensis boliviensis sbo-miR-27b
    41. Salmo salar ssa-miR-27b-3p
    42. Sarcophilus harrisii (Tasmanian devil) sha-miR-27b
    43. Sus scrofa ssc-miR-27b-3p
    44. Taeniopygia guttata (zebra finch) tgu-miR-27-3p
    45. Tupaia chinensis (Chinese tree shrew) tch-miR-27b-3p
    46. Tursiops truncatus miR-27b
    47. Xenopus laevis xla-miR-27b
    48. Xenopus tropicalis xtr-miR-27b