Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila bipectinata (Fruit fly) tRNA-Leu secondary structure diagram

Drosophila bipectinata (Fruit fly) tRNA-Leu URS0000592212_42026

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAGGAUGGCCGAGCGGUCUAAGGCGCCAGACUCAAGUUCUGGUCCUCUCUGAGGGCGUGGGUUCGAAUCCCACUUCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 114 other species

  1. Acromyrmex echinatior tRNA-Leu
  2. Agrilus planipennis tRNA-Leu
  3. Amyelois transitella tRNA-Leu
  4. Anastrepha ludens (Mexican fruit fly) transfer RNA leucine (anticodon CAA)
  5. Anastrepha obliqua (WestIndian fruit fly) transfer RNA leucine (anticodon CAA)
  6. Anopheles gambiae str. PEST tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 3)
  7. Anthonomus grandis grandis (Boll weevil) transfer RNA leucine (anticodon CAA)
  8. Apis dorsata tRNA-Leu
  9. Apis florea tRNA-Leu
  10. Apis mellifera tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1, tRNA-Leu-CAA-1-2)
  11. Athalia rosae (Coleseed sawfly) tRNA-Leu
  12. Atta cephalotes (Leaf-cutter ant) tRNA LOC105616920-3
  13. Bactrocera dorsalis tRNA-Leu
  14. Bactrocera latifrons tRNA-Leu
  15. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA leucine (anticodon CAA)
  16. Bicyclus anynana (Squinting bush brown) tRNA-Leu
  17. Blattella germanica tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  18. Bombus affinis (Rusty patched bumble bee) transfer RNA leucine (anticodon CAA)
  19. Bombus huntii (Hunt's bumblebee) transfer RNA leucine (anticodon CAA)
  20. Bombus terrestris tRNA LOC110119794
  21. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Leu
  22. Bombyx mandarina tRNA-Leu
  23. Bombyx mori tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  24. Camponotus floridanus tRNA-Leu
  25. Cataglyphis hispanica (Desert ant) transfer RNA leucine (anticodon CAA)
  26. Ceratitis capitata (Mediterranean fruit fly) tRNA-Leu
  27. Chelonus insularis tRNA-Leu
  28. Cherax quadricarinatus (Australian red claw crayfish) transfer RNA leucine (anticodon CAA)
  29. Cimex lectularius tRNA-Leu
  30. Copidosoma floridanum tRNA-Leu
  31. Cotesia glomerata tRNA-Leu
  32. Culex pipiens pallens (Northern house mosquito) transfer RNA leucine (anticodon CAA)
  33. Culex quinquefasciatus tRNA-Leu
  34. Drosophila albomicans (Fruit fly) transfer RNA leucine (anticodon CAA)
  35. Drosophila ananassae tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  36. Drosophila arizonae (Fruit fly) tRNA-Leu
  37. Drosophila biarmipes (Fruit fly) transfer RNA leucine (anticodon CAA)
  38. Drosophila busckii (Fruit fly) tRNA-Leu
  39. Drosophila elegans (Fruit fly) tRNA-Leu
  40. Drosophila erecta tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  41. Drosophila eugracilis (Fruit fly) tRNA-Leu
  42. Drosophila ficusphila (Fruit fly) tRNA-Leu
  43. Drosophila grimshawi tRNA-Leu (CAA) (tRNA-Leu-CAA-2-1, tRNA-Leu-CAA-2-2)
  44. Drosophila guanche (Fruit fly) tRNA-Leu
  45. Drosophila gunungcola (Fruit fly) transfer RNA leucine (anticodon CAA)
  46. Drosophila hydei (Fruit fly) tRNA-Leu
  47. Drosophila innubila (Fruit fly) tRNA-Leu
  48. Drosophila kikkawai (Fruit fly) tRNA-Leu
  49. Drosophila mauritiana (Fruit fly) tRNA-Leu
  50. Drosophila melanogaster transfer RNA:Leucine-CAA 2-3 (Dmel_CR31143, Dmel_CR32127, Dmel_CR32841)
  51. Drosophila miranda (Fruit fly) tRNA-Leu
  52. Drosophila mojavensis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  53. Drosophila navojoa (Fruit fly) tRNA-Leu
  54. Drosophila obscura (Fruit fly) tRNA-Leu
  55. Drosophila persimilis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 3)
  56. Drosophila pseudoobscura (Fruit fly) tRNA-Leu
  57. Drosophila pseudoobscura pseudoobscura tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  58. Drosophila rhopaloa (Fruit fly) tRNA-Leu
  59. Drosophila santomea (Fruit fly) tRNA-Leu
  60. Drosophila sechellia tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  61. Drosophila simulans tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  62. Drosophila subobscura (Fruit fly) tRNA-Leu
  63. Drosophila subpulchrella (Fruit fly) tRNA-Leu
  64. Drosophila suzukii (Fruit fly) tRNA-Leu
  65. Drosophila takahashii (Fruit fly) tRNA-Leu
  66. Drosophila teissieri (Fruit fly) tRNA-Leu
  67. Drosophila virilis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  68. Drosophila willistoni tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 6)
  69. Drosophila yakuba tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  70. Dufourea novaeangliae (Bee) tRNA-Leu
  71. Eufriesea mexicana (Bee) tRNA-Leu
  72. Frieseomelitta varia (marmelada) tRNA-Leu
  73. Galleria mellonella tRNA-Leu
  74. Habropoda laboriosa (Southeastern blueberry bee) tRNA-Leu
  75. Harpegnathos saltator (Indian jumping ant) tRNA-Leu
  76. Helicoverpa armigera transfer RNA leucine (anticodon CAA)
  77. Helicoverpa zea (Corn earworm) tRNA-Leu
  78. Hermetia illucens (Black soldier fly) tRNA-Leu
  79. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA leucine (anticodon CAA)
  80. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA leucine (anticodon CAA)
  81. Leguminivora glycinivorella (Soybean pod borer) tRNA-Leu
  82. Lucilia cuprina tRNA-Leu
  83. Malaya genurostris (Mosquitos) transfer RNA leucine (anticodon CAA)
  84. Manduca sexta tRNA-Leu
  85. Megachile rotundata tRNA-Leu
  86. Microplitis demolitor (Parasitoid wasp) transfer RNA leucine (anticodon CAA)
  87. Microplitis mediator (Endoparasitoid wasp) transfer RNA leucine (anticodon CAA)
  88. Monomorium pharaonis (Pharaoh ant) tRNA-Leu
  89. Nasonia vitripennis (Jewel wasp) tRNA-Leu
  90. Neodiprion lecontei tRNA-Leu
  91. Neodiprion pinetum (White pine sawfly) tRNA-Leu
  92. Onthophagus taurus tRNA-Leu
  93. Ooceraea biroi tRNA-Leu
  94. Orussus abietinus (Parasitic wood wasp) tRNA-Leu
  95. Pararge aegeria tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  96. Pectinophora gossypiella (Pink bollworm) transfer RNA leucine (anticodon CAA)
  97. Plodia interpunctella (Indianmeal moth) transfer RNA leucine (anticodon CAA)
  98. Pogonomyrmex barbatus (Red harvester ant) tRNA-Leu
  99. Polistes canadensis (Red paper wasp) tRNA-Leu
  100. Polistes dominula (European paper wasp) tRNA-Leu
  101. Polistes fuscatus tRNA-Leu
  102. Rhagoletis pomonella (Apple magot fly) tRNA-Leu
  103. Sitophilus oryzae tRNA-Leu
  104. Spodoptera frugiperda tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 7)
  105. Stomoxys calcitrans (Stable fly) tRNA-Leu
  106. Topomyia yanbarensis (Mosquitos) transfer RNA leucine (anticodon CAA)
  107. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA leucine (anticodon CAA)
  108. Trichogramma pretiosum (Parasitoid wasp) tRNA-Leu
  109. Trichomalopsis sarcophagae tRNA-OTHER
  110. Uranotaenia lowii (Mosquitos) transfer RNA leucine (anticodon CAA)
  111. Venturia canescens (Endoparasitoid wasp) tRNA-Leu
  112. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA leucine (anticodon CAA)
  113. Zerene cesonia tRNA-Leu
  114. Zeugodacus cucurbitae (Melon fly) transfer RNA leucine (anticodon CAA)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...