Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Leguminivora glycinivorella (Soybean pod borer) tRNA-Leu secondary structure diagram

Leguminivora glycinivorella (Soybean pod borer) tRNA-Leu URS0000592212_1035111

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAGGAUGGCCGAGCGGUCUAAGGCGCCAGACUCAAGUUCUGGUCCUCUCUGAGGGCGUGGGUUCGAAUCCCACUUCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 127 other species

  1. Acromyrmex echinatior tRNA-Leu
  2. Aedes aegypti tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 14)
  3. Agrilus planipennis (Emerald ash borer) tRNA-Leu
  4. Amyelois transitella (Moths) transfer RNA leucine (anticodon CAA)
  5. Anastrepha ludens (Mexican fruit fly) transfer RNA leucine (anticodon CAA)
  6. Anastrepha obliqua (WestIndian fruit fly) transfer RNA leucine (anticodon CAA)
  7. Anopheles albimanus (Mosquitos) tRNA-Leu
  8. Anopheles gambiae str. PEST tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 3)
  9. Anthonomus grandis grandis transfer RNA leucine (anticodon CAA)
  10. Apis dorsata (Giant honeybee) tRNA-Leu
  11. Apis florea tRNA-Leu
  12. Apis mellifera tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1, tRNA-Leu-CAA-1-2)
  13. Athalia rosae (Coleseed sawfly) tRNA-Leu
  14. Atta cephalotes tRNA LOC105616920-3
  15. Bactrocera dorsalis transfer RNA leucine (anticodon CAA)
  16. Bactrocera latifrons (Solanum fruit fly) tRNA-Leu
  17. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA leucine (anticodon CAA)
  18. Bactrocera oleae (Olive fruit fly) tRNA-Leu
  19. Bicyclus anynana (Squinting bush brown) tRNA-Leu
  20. Blattella germanica tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  21. Bombus affinis (Rusty patched bumble bee) transfer RNA leucine (anticodon CAA)
  22. Bombus huntii (Hunt's bumblebee) transfer RNA leucine (anticodon CAA)
  23. Bombus impatiens (Common eastern bumblebee) tRNA-Leu
  24. Bombus terrestris (Buff-tailed bumblebee) tRNA LOC110119794
  25. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Leu
  26. Bombyx mandarina (Wild silkworm) tRNA-Leu
  27. Bombyx mori tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  28. Camponotus floridanus tRNA-Leu
  29. Cataglyphis hispanica (Desert ant) transfer RNA leucine (anticodon CAA)
  30. Ceratitis capitata tRNA-Leu
  31. Chelonus insularis tRNA-Leu
  32. Cherax quadricarinatus (Australian red claw crayfish) transfer RNA leucine (anticodon CAA)
  33. Chrysoperla carnea (Green lacewing) tRNA-Leu
  34. Cimex lectularius tRNA-Leu
  35. Copidosoma floridanum tRNA-Leu
  36. Cotesia glomerata tRNA-Leu
  37. Culex pipiens pallens (Northern house mosquito) transfer RNA leucine (anticodon CAA)
  38. Culex quinquefasciatus tRNA-Leu
  39. Cydia pomonella (The codling moth) transfer RNA leucine (anticodon CAA)
  40. Danaus plexippus plexippus (Monarch butterfly) tRNA-Leu
  41. Drosophila albomicans (Fruit fly) transfer RNA leucine (anticodon CAA)
  42. Drosophila ananassae tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  43. Drosophila arizonae (Fruit fly) tRNA-Leu
  44. Drosophila biarmipes (Fruit fly) transfer RNA leucine (anticodon CAA)
  45. Drosophila bipectinata (Pomace flies) transfer RNA leucine (anticodon CAA)
  46. Drosophila busckii (Fruit fly) tRNA-Leu
  47. Drosophila elegans (Pomace flies) tRNA-Leu
  48. Drosophila erecta tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  49. Drosophila eugracilis (Fruit fly) tRNA-Leu
  50. Drosophila ficusphila (Fruit fly) tRNA-Leu
  51. Drosophila grimshawi tRNA-Leu (CAA) (tRNA-Leu-CAA-2-1, tRNA-Leu-CAA-2-2)
  52. Drosophila guanche (Fruit fly) tRNA-Leu
  53. Drosophila gunungcola (Fruit fly) transfer RNA leucine (anticodon CAA)
  54. Drosophila hydei (Fruit fly) tRNA-Leu
  55. Drosophila innubila (Fruit fly) tRNA-Leu
  56. Drosophila kikkawai (Pomace flies) transfer RNA leucine (anticodon CAA)
  57. Drosophila mauritiana (Fruit fly) tRNA-Leu
  58. Drosophila melanogaster (fruit fly) transfer RNA:Leucine-CAA 2-3 (Dmel_CR31143, Dmel_CR32127, Dmel_CR32841)
  59. Drosophila miranda (Fruit fly) tRNA-Leu
  60. Drosophila mojavensis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  61. Drosophila montana (Pomace flies) transfer RNA leucine (anticodon CAA)
  62. Drosophila nasuta (Pomace flies) transfer RNA leucine (anticodon CAA)
  63. Drosophila navojoa (Fruit fly) tRNA-Leu
  64. Drosophila novamexicana (Pomace flies) tRNA-Leu
  65. Drosophila obscura (Fruit fly) tRNA-Leu
  66. Drosophila persimilis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 3)
  67. Drosophila pseudoobscura (Fruit fly) tRNA-Leu
  68. Drosophila pseudoobscura pseudoobscura tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  69. Drosophila rhopaloa (Fruit fly) tRNA-Leu
  70. Drosophila santomea (Fruit fly) tRNA-Leu
  71. Drosophila sechellia tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  72. Drosophila serrata (Pomace flies) tRNA-Leu
  73. Drosophila simulans tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  74. Drosophila subobscura (Fruit fly) tRNA-Leu
  75. Drosophila subpulchrella (Fruit fly) tRNA-Leu
  76. Drosophila sulfurigaster albostrigata (Flies) transfer RNA leucine (anticodon CAA)
  77. Drosophila suzukii (Pomace flies) transfer RNA leucine (anticodon CAA)
  78. Drosophila takahashii (Pomace flies) transfer RNA leucine (anticodon CAA)
  79. Drosophila teissieri (Fruit fly) tRNA-Leu
  80. Drosophila tropicalis (Pomace flies) transfer RNA leucine (anticodon CAA)
  81. Drosophila virilis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  82. Drosophila willistoni tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 6)
  83. Drosophila yakuba tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  84. Dufourea novaeangliae tRNA-Leu
  85. Eufriesea mexicana tRNA-Leu
  86. Frieseomelitta varia tRNA-Leu
  87. Galleria mellonella (Greater wax moth) tRNA-Leu
  88. Glossina fuscipes (Tsetse fly) tRNA-Leu
  89. Habropoda laboriosa tRNA-Leu
  90. Harpegnathos saltator (Indian jumping ant) tRNA-Leu
  91. Helicoverpa armigera (Cotton bollworm) transfer RNA leucine (anticodon CAA)
  92. Helicoverpa zea tRNA-Leu
  93. Hermetia illucens tRNA-Leu
  94. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA leucine (anticodon CAA)
  95. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA leucine (anticodon CAA)
  96. Lucilia cuprina tRNA-Leu
  97. Lucilia sericata (Common green bottle fly) tRNA-Leu
  98. Malaya genurostris (Mosquitos) transfer RNA leucine (anticodon CAA)
  99. Manduca sexta tRNA-Leu
  100. Megachile rotundata tRNA-Leu
  101. Microplitis demolitor (Parasitoid wasp) transfer RNA leucine (anticodon CAA)
  102. Microplitis mediator (Endoparasitoid wasp) transfer RNA leucine (anticodon CAA)
  103. Monomorium pharaonis tRNA-Leu
  104. Nasonia vitripennis (Jewel wasp) tRNA-Leu
  105. Neodiprion lecontei tRNA-Leu
  106. Neodiprion pinetum tRNA-Leu
  107. Onthophagus taurus tRNA-Leu
  108. Ooceraea biroi tRNA-Leu
  109. Orussus abietinus (Parasitic wood wasp) tRNA-Leu
  110. Pararge aegeria tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  111. Pectinophora gossypiella transfer RNA leucine (anticodon CAA)
  112. Plodia interpunctella (Indianmeal moth) transfer RNA leucine (anticodon CAA)
  113. Pogonomyrmex barbatus tRNA-Leu
  114. Polistes canadensis (Red paper wasp) tRNA-Leu
  115. Polistes dominula tRNA-Leu
  116. Polistes fuscatus tRNA-Leu
  117. Rhagoletis pomonella (Apple magot fly) tRNA-Leu
  118. Sitophilus oryzae (Rice weevil) tRNA-Leu
  119. Solenopsis invicta tRNA-Leu
  120. Spodoptera frugiperda tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 7)
  121. Stomoxys calcitrans tRNA-Leu
  122. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Leu
  123. Topomyia yanbarensis (Mosquitos) transfer RNA leucine (anticodon CAA)
  124. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA leucine (anticodon CAA)
  125. Tribolium castaneum (Red flour beetle) transfer RNA leucine (anticodon CAA)
  126. Trichogramma pretiosum (Parasitoid wasp) tRNA-Leu
  127. Trichomalopsis sarcophagae tRNA-OTHER
  128. Uranotaenia lowii (Mosquitos) transfer RNA leucine (anticodon CAA)
  129. Venturia canescens tRNA-Leu
  130. Vespa mandarinia (Asian giant hornet) tRNA-Leu
  131. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA leucine (anticodon CAA)
  132. Zerene cesonia (Southern Dogface) tRNA-Leu
  133. Zeugodacus cucurbitae (Melon fly) transfer RNA leucine (anticodon CAA)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications