Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bombus huntii (Hunt's bumblebee) transfer RNA leucine (anticodon CAA) secondary structure diagram

Bombus huntii (Hunt's bumblebee) transfer RNA leucine (anticodon CAA) URS0000592212_85661

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAGGAUGGCCGAGCGGUCUAAGGCGCCAGACUCAAGUUCUGGUCCUCUCUGAGGGCGUGGGUUCGAAUCCCACUUCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 73 other species

  1. Acromyrmex echinatior tRNA-Leu
  2. Agrilus planipennis tRNA-Leu
  3. Amyelois transitella tRNA-Leu
  4. Anopheles gambiae str. PEST tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 3)
  5. Anthonomus grandis grandis transfer RNA leucine (anticodon CAA)
  6. Apis dorsata tRNA-Leu
  7. Apis florea (Dwarf honeybee) tRNA-Leu
  8. Apis mellifera tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1, tRNA-Leu-CAA-1-2)
  9. Athalia rosae tRNA-Leu
  10. Atta cephalotes tRNA LOC105616920-3
  11. Bactrocera dorsalis (Oriental fruit fly) tRNA-Leu
  12. Bactrocera latifrons (Solanum fruit fly) tRNA-Leu
  13. Bicyclus anynana tRNA-Leu
  14. Blattella germanica tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  15. Bombus terrestris (Buff-tailed bumblebee) tRNA LOC110119794
  16. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Leu
  17. Bombyx mandarina tRNA-Leu
  18. Bombyx mori tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  19. Camponotus floridanus tRNA-Leu
  20. Cataglyphis hispanica (Desert ant) transfer RNA leucine (anticodon CAA)
  21. Ceratitis capitata (Mediterranean fruit fly) tRNA-Leu
  22. Chelonus insularis tRNA-Leu
  23. Cimex lectularius (Bed bug) tRNA-Leu
  24. Copidosoma floridanum (Parasitoid wasp) tRNA-Leu
  25. Cotesia glomerata tRNA-Leu
  26. Culex quinquefasciatus tRNA-Leu
  27. Drosophila ananassae tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  28. Drosophila erecta tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  29. Drosophila grimshawi tRNA-Leu (CAA) (tRNA-Leu-CAA-2-1, tRNA-Leu-CAA-2-2)
  30. Drosophila gunungcola tRNA-OTHER
  31. Drosophila melanogaster (fruit fly) transfer RNA:Leucine-CAA 2-3 (Dmel_CR31143, Dmel_CR32127, Dmel_CR32841)
  32. Drosophila mojavensis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  33. Drosophila persimilis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 3)
  34. Drosophila pseudoobscura pseudoobscura tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  35. Drosophila sechellia tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  36. Drosophila simulans tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  37. Drosophila virilis tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  38. Drosophila willistoni tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 6)
  39. Drosophila yakuba tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 4)
  40. Dufourea novaeangliae (Bee) tRNA-Leu
  41. Eufriesea mexicana (Bee) tRNA-Leu
  42. Frieseomelitta varia (marmelada) tRNA-Leu
  43. Galleria mellonella (Greater wax moth) tRNA-Leu
  44. Habropoda laboriosa (Southeastern blueberry bee) tRNA-Leu
  45. Harpegnathos saltator tRNA-Leu
  46. Helicoverpa armigera transfer RNA leucine (anticodon CAA)
  47. Helicoverpa zea tRNA-Leu
  48. Hermetia illucens (Black soldier fly) tRNA-Leu
  49. Leguminivora glycinivorella (Soybean pod borer) tRNA-Leu
  50. Lucilia cuprina (Australian sheep blowfly) tRNA-Leu
  51. Manduca sexta tRNA-Leu
  52. Megachile rotundata tRNA-Leu
  53. Monomorium pharaonis tRNA-Leu
  54. Nasonia vitripennis (Jewel wasp) tRNA-Leu
  55. Neodiprion lecontei tRNA-Leu
  56. Neodiprion pinetum (White pine sawfly) tRNA-Leu
  57. Onthophagus taurus (Dung beetle) tRNA-Leu
  58. Ooceraea biroi (Clonal raider ant) tRNA-Leu
  59. Orussus abietinus tRNA-Leu
  60. Pararge aegeria tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 5)
  61. Pectinophora gossypiella transfer RNA leucine (anticodon CAA)
  62. Pogonomyrmex barbatus tRNA-Leu
  63. Polistes canadensis tRNA-Leu
  64. Polistes dominula (European paper wasp) tRNA-Leu
  65. Polistes fuscatus (Common paper wasp) tRNA-Leu
  66. Rhagoletis pomonella tRNA-Leu
  67. Sitophilus oryzae tRNA-Leu
  68. Spodoptera frugiperda tRNA-Leu (CAA) (tRNA-Leu-CAA-1 1 to 7)
  69. Stomoxys calcitrans tRNA-Leu
  70. Trichogramma pretiosum (Parasitoid wasp) tRNA-Leu
  71. Trichomalopsis sarcophagae tRNA-OTHER
  72. Venturia canescens (Endoparasitoid wasp) tRNA-Leu
  73. Zerene cesonia tRNA-Leu
2D structure