Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-7-5p URS0000591950_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-7: Bmo-mir-7 is a microRNA that has been studied in relation to its regulating relationships with Bmhairy [PMC4222307]. Western blotting analyses have shown that Bmo-mir-7 is a potentially fine-tuned target rather than a turn-on/turn-off target [PMC4222307]. The minimum free energy for hybridization has been determined to be -28.2 kcal/mol between BmEm4 and bmo-mir-7 and -17.6 kcal/mol between BmEm4 and bmo-mir-79 [PMC4222307]. A transfection vector containing the Bmyan 3'-UTR and the luciferase reporter gene was constructed, and luciferase activity analysis revealed a recognition site of bmo-mir-7 on the Bmyan 3'-UTR [PMC4222307]. The minimum free energy for hybridization between BmEm4 and bmo-mir-7 has also been predicted by mFold analysis to be -28.2 kcal/mol [PMC2760746]. The Drosophila orthologue of bmo-mir-7 has been identified in the nervous system, where it may play a role in segmentation, sensory organ development, and Notch signal transduction [PMC2835664]. The expression of bmo-mir-7 remains relatively stable throughout 14 development stages, with only weak increases observed at certain stages for bmo-miR-275 [PMC2500172]. Additionally, it has been found that certain homologs of six genes in Bombyx mori can bind perfectly to mir-2 (bmo-miR-2a, bmo-miR-2b, bmo-miR13a*, and bmo-miR13b) as well as to bmo mir-7 [PMC2435238].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAGACUAGUGAUUUUGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 61 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-7
  2. Alligator mississippiensis (American alligator) ami-miR-7a-5p
  3. Anolis carolinensis (green anole) aca-miR-7-5p
  4. Anopheles gambiae aga-miR-7
  5. Apis mellifera ame-miR-7-5p
  6. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-7-5p
  7. Branchiostoma floridae (Florida lancelet) bfl-miR-7
  8. Branchiostoma lanceolatum Bla-Mir-7_5p (mature (guide))
  9. Callorhinchus milii Cmi-Mir-7-P1_5p (mature (guide))
  10. Canis lupus familiaris (dog) cfa-miR-7
  11. Centruroides sculpturatus (bark scorpion) Csc-Mir-7-P14_5p (mature (guide))
  12. Chrysemys picta bellii Cpi-Mir-7-P1_5p (mature (guide))
  13. Ciona savignyi (Pacific transparent sea squirt) csa-miR-7
  14. Cricetulus griseus cgr-miR-7a
  15. Culex quinquefasciatus cqu-miR-7
  16. Danio rerio (zebrafish) dre-miR-7a
  17. Daphnia pulex (common water flea) dpu-miR-7
  18. Drosophila ananassae dan-miR-7
  19. Drosophila erecta der-miR-7
  20. Drosophila grimshawi dgr-miR-7
  21. Drosophila melanogaster (fruit fly) dme-miR-7-5p
  22. Drosophila mojavensis dmo-miR-7
  23. Drosophila persimilis dpe-miR-7
  24. Drosophila pseudoobscura dps-miR-7
  25. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294419_df_nrg
  26. Drosophila sechellia dse-miR-7
  27. Drosophila simulans dsi-miR-7
  28. Drosophila willistoni dwi-miR-7
  29. Drosophila yakuba dya-miR-7
  30. Equus caballus (horse) eca-miR-7
  31. Gadus morhua gmo-miR-7c-5p
  32. Gallus gallus Gallus_gallus piRNA piR-gga-291
  33. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-7
  34. Homo sapiens (human) hsa-miR-7-5p
  35. Ictalurus punctatus (channel catfish) ipu-miR-7a
  36. Ixodes scapularis (black-legged tick) isc-miR-7
  37. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-7_5p (mature (guide))
  38. Lytechinus variegatus lva-miR-7-5p
  39. Macaca mulatta (Rhesus monkey) mml-miR-7
  40. Maylandia zebra (zebra mbuna) mze-miR-7b
  41. Monopterus albus Mal-Mir-7-P4a_5p (mature (guide))
  42. Mus musculus (house mouse) mmu-miR-7a-5p
  43. Nasonia longicornis nlo-miR-7
  44. Nasonia vitripennis (jewel wasp) nvi-miR-7
  45. Neolamprologus brichardi (lyretail cichlid) nbr-miR-7
  46. Oreochromis niloticus oni-miR-7
  47. Ornithorhynchus anatinus (platypus) oan-miR-7-5p
  48. Pan troglodytes ptr-miR-7
  49. Patiria miniata (sea bat) pmi-miR-7-5p
  50. Petromyzon marinus pma-miR-7a-5p
  51. Pundamilia nyererei pny-miR-7
  52. Rattus norvegicus rno-miR-7a-5p
  53. Saccoglossus kowalevskii sko-miR-7-5p
  54. Salmo salar ssa-miR-7a-5p
  55. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-7
  56. Taeniopygia guttata tgu-miR-7-5p
  57. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-7
  58. Tor tambroides miR-7a
  59. Xenopus laevis (African clawed frog) xla-miR-7
  60. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1139785
  61. Xenoturbella bocki Xbo-Mir-7_5p (mature (guide))
Publications