v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-7 URS0000591950_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-miR-7: Cfa-mir-7 is a specific type of miRNA that has been identified in only one comparison [PMC9617701]. In a study conducted on dog pituitary samples, it was found that cfa-mir-7, along with cfa-miR-30 family and cfa-miR-125 family, exhibited the highest activity [PMC4768678]. Similarly, in dog adrenal cortex samples, cfa-mir-7 family was also found to be one of the miRNAs with the highest activity [PMC4768678]. In both pituitary and adrenal cortex samples, cfa-miR-99a and cfa-miR-30 family were consistently identified as highly abundant miRNAs [PMC4768678]. Additionally, the study revealed that cfa-miR-26 family was also abundant in adrenal cortex samples [PMC4768678]. The specific miRNA probes used in the study included miR-551b, miR-375, miR-216a, and miR-7 [PMC6212914]. These findings provide valuable insights into the expression patterns of different miRNAs in dog pituitary and adrenal cortex tissues.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAGACUAGUGAUUUUGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 61 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-7
  2. Alligator mississippiensis (American alligator) ami-miR-7a-5p
  3. Anolis carolinensis (green anole) aca-miR-7-5p
  4. Anopheles gambiae aga-miR-7
  5. Apis mellifera ame-miR-7-5p
  6. Bombyx mori (domestic silkworm) bmo-miR-7-5p
  7. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-7-5p
  8. Branchiostoma floridae (Florida lancelet) bfl-miR-7
  9. Branchiostoma lanceolatum Bla-Mir-7_5p (mature (guide))
  10. Callorhinchus milii Cmi-Mir-7-P1_5p (mature (guide))
  11. Centruroides sculpturatus (bark scorpion) Csc-Mir-7-P14_5p (mature (guide))
  12. Chrysemys picta bellii Cpi-Mir-7-P1_5p (mature (guide))
  13. Ciona savignyi (Pacific transparent sea squirt) csa-miR-7
  14. Cricetulus griseus cgr-miR-7a
  15. Culex quinquefasciatus cqu-miR-7
  16. Danio rerio (zebrafish) dre-miR-7a
  17. Daphnia pulex (common water flea) dpu-miR-7
  18. Drosophila ananassae dan-miR-7
  19. Drosophila erecta der-miR-7
  20. Drosophila grimshawi dgr-miR-7
  21. Drosophila melanogaster (fruit fly) dme-miR-7-5p
  22. Drosophila mojavensis dmo-miR-7
  23. Drosophila persimilis dpe-miR-7
  24. Drosophila pseudoobscura dps-miR-7
  25. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294419_df_nrg
  26. Drosophila sechellia dse-miR-7
  27. Drosophila simulans dsi-miR-7
  28. Drosophila willistoni dwi-miR-7
  29. Drosophila yakuba dya-miR-7
  30. Equus caballus (horse) eca-miR-7
  31. Gadus morhua gmo-miR-7c-5p
  32. Gallus gallus Gallus_gallus piRNA piR-gga-291
  33. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-7
  34. Homo sapiens (human) hsa-miR-7-5p
  35. Ictalurus punctatus (channel catfish) ipu-miR-7a
  36. Ixodes scapularis (black-legged tick) isc-miR-7
  37. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-7_5p (mature (guide))
  38. Lytechinus variegatus lva-miR-7-5p
  39. Macaca mulatta (Rhesus monkey) mml-miR-7
  40. Maylandia zebra (zebra mbuna) mze-miR-7b
  41. Monopterus albus Mal-Mir-7-P4a_5p (mature (guide))
  42. Mus musculus (house mouse) mmu-miR-7a-5p
  43. Nasonia longicornis nlo-miR-7
  44. Nasonia vitripennis (jewel wasp) nvi-miR-7
  45. Neolamprologus brichardi (lyretail cichlid) nbr-miR-7
  46. Oreochromis niloticus oni-miR-7
  47. Ornithorhynchus anatinus (platypus) oan-miR-7-5p
  48. Pan troglodytes ptr-miR-7
  49. Patiria miniata (sea bat) pmi-miR-7-5p
  50. Petromyzon marinus pma-miR-7a-5p
  51. Pundamilia nyererei pny-miR-7
  52. Rattus norvegicus rno-miR-7a-5p
  53. Saccoglossus kowalevskii sko-miR-7-5p
  54. Salmo salar ssa-miR-7a-5p
  55. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-7
  56. Taeniopygia guttata tgu-miR-7-5p
  57. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-7
  58. Tor tambroides miR-7a
  59. Xenopus laevis (African clawed frog) xla-miR-7
  60. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1139785
  61. Xenoturbella bocki Xbo-Mir-7_5p (mature (guide))
 Publications