v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ophiophagus hannah (king cobra) oha-miR-217-5p URS000058F867_8665

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UACUGCAUCAGGAACUGAUUGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus (cattle) bta-miR-217
  2. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-454585
  3. Canis lupus familiaris (dog) cfa-miR-217
  4. Gallus gallus gga-miR-217-5p
  5. Gorilla gorilla gorilla ggo-miR-217 (MIR217)
  6. Gorilla gorilla ggo-miR-217
  7. Monodelphis domestica mdo-miR-217
  8. Pan paniscus (pygmy chimpanzee) ppa-miR-217
  9. Sus scrofa (pig) ssc-miR-217
  10. Xenopus tropicalis (tropical clawed frog) xtr-miR-217