Canis lupus familiaris (dog) cfa-miR-217 URS000058F867_9615

• 24 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 10 other species
• 52 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UACUGCAUCAGGAACUGAUUGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

1. Bos taurus (cattle) bta-miR-217
2. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-454585
3. Gallus gallus gga-miR-217-5p
4. Gorilla gorilla gorilla ggo-miR-217 (MIR217)
5. Gorilla gorilla ggo-miR-217
6. Monodelphis domestica mdo-miR-217
7. Ophiophagus hannah oha-miR-217-5p
8. Pan paniscus (pygmy chimpanzee) ppa-miR-217
9. Sus scrofa (pig) ssc-miR-217
10. Xenopus tropicalis (tropical clawed frog) xtr-miR-217

Publications Download

• FASTA
• JSON