Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-217 URS000058F867_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-217: Ssc-mir-217 is a microRNA (miRNA) that has been studied in various contexts. In a study, it was found that ssc-mir-217, along with other miRNAs, showed differential expression patterns in pigs [PMC9622794]. Specifically, ssc-mir-217 was found to be up-regulated along with miR-383-x, miR-409-y, novel-m0003-5p, and novel-m0042-3p [PMC9622794]. On the other hand, ssc-mir-217 was also found to be down-regulated along with ssc-miR-31, miR-29-y, miR-93-y, and novel-m0010-5p [PMC9622794]. The authenticity of the sequencing data for these miRNAs was validated using RT-qPCR [PMC9622794]. Ssc-miR-216 and ssc-mir-217 were found to be located in the same genome loci on chromosome 3 [PMC4934789]. In another study comparing pig and human pluripotent stem cells (PSCs), it was observed that ssc-mir-217 showed higher expression levels in pig PSCs compared to human PSCs [PMC4934789]. Furthermore, it was found that ssc-miR-182 and ssc-miR187 were also more highly expressed in pig PSCs [PMC4934789]. Ssc-mir 182 is involved in the regulation of the Neurotrophin signaling pathway by targeting genes such as BNDF, SHC4 KRAS and FOXO3. Similarly,scc mir 216,scc mir 142,scc mir 96,scc mir 182,and scc mir183 have higher expression levels in mpiPSCs compared to hpiPSCs[PMC4934789]. Additionally, ssc-mir-217 was found to negatively regulate the G1/S transition in the mitotic cell cycle [PMC7429792].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUGCAUCAGGAACUGAUUGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus (cattle) bta-miR-217
  2. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-454585
  3. Canis lupus familiaris (dog) cfa-miR-217
  4. Gallus gallus gga-miR-217-5p
  5. Gorilla gorilla gorilla ggo-miR-217 (MIR217)
  6. Gorilla gorilla ggo-miR-217
  7. Monodelphis domestica mdo-miR-217
  8. Ophiophagus hannah oha-miR-217-5p
  9. Pan paniscus (pygmy chimpanzee) ppa-miR-217
  10. Xenopus tropicalis (tropical clawed frog) xtr-miR-217
Publications