Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-219a-5p URS0000565C8D_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, miRBase, TarBase, GeneCards, RefSeq, MalaCards, PSICQUIC, IntAct). Described in 61 papers. Homo sapiens (human) hsa-miR-219a-5p sequence is a product of mir-219, hsa-miR-219a, 219, miR-219a, hsa-miR-219a-5p, miR-219, MIR219A2, miR-219a-5p, MIR219A1 genes. Found in the human reference genome. Interacts with protein-coding genes, including 11B6, 2C4D, 39K2, A2BP1, AASS, AAVR, ABHD2, ACSF3, AD-015, AD035.

Interactions 8

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-219a-5p interacts with:

Interaction id Participant Synonyms
EBI-25473545 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
URS0000565C8D_9606-1 P10636 P10636
URS0000565C8D_9606-0 P10636 P10636
URS0000565C8D_9606-4 P10636 P10636
URS0000565C8D_9606-5 P49841 P49841
URS0000565C8D_9606-2 P49841 P49841
URS0000565C8D_9606-6 Q5TCY1 Q5TCY1
URS0000565C8D_9606-3 Q5TCY1 Q5TCY1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAUUGUCCAAACGCAAUUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-219-5p
    2. Branchiostoma floridae bfl-miR-219
    3. Canis lupus familiaris (dog) cfa-miR-219-5p
    4. Capitella teleta cte-miR-219
    5. Capra hircus chi-miR-219
    6. Drosophila erecta miR-219-RA
    7. Drosophila melanogaster (fruit fly) dme-miR-219-5p
    8. Drosophila mojavensis miR-219-RA
    9. Drosophila pseudoobscura pseudoobscura miR-219-RA
    10. Drosophila virilis miR-219-RA
    11. Drosophila yakuba miR-219-RA
    12. Equus caballus eca-miR-219-5p
    13. Gallus gallus (chicken) gga-miR-219a
    14. Gorilla gorilla (western gorilla) ggo-miR-219
    15. Macaca mulatta mml-miR-219
    16. Monodelphis domestica (gray short-tailed opossum) mdo-miR-219-5p
    17. Mus musculus mmu-miR-219a-5p
    18. Pan troglodytes (chimpanzee) ptr-miR-219-5p
    19. Pongo pygmaeus ppy-miR-219-5p
    20. Pteropus alecto (black flying fox) pal-miR-219a-5p
    21. Rattus norvegicus rno-miR-219a-5p
    22. Tribolium castaneum tca-miR-219-5p
    23. Xenopus tropicalis xtr-miR-219