Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-219a-5p URS0000565C8D_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (MalaCards, miRBase, GeneCards, IntAct, TarBase, ENA, RefSeq). Homo sapiens (human) hsa-miR-219a-5p sequence is a product of hsa-miR-219a, miR-219a-5p, hsa-miR-219a-5p, MIR219A1, mir-219, MIR219A2, miR-219, miR-219a, 219 genes. Found in the Homo sapiens reference genome. Interacts with protein-coding genes, including 11B6, 2C4D, 39K2, A2BP1, AASS, AAVR, ABHD2, ACSF3, AD-015, AD035.

mRNA interactions 4 total

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAUUGUCCAAACGCAAUUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 23 other species

    1. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-219-5p
    2. Branchiostoma floridae (Florida lancelet) bfl-miR-219
    3. Canis lupus familiaris (dog) cfa-miR-219-5p
    4. Capitella teleta cte-miR-219
    5. Capra hircus chi-miR-219
    6. Drosophila erecta miR-219-RA
    7. Drosophila melanogaster dme-miR-219-5p
    8. Drosophila mojavensis miR-219-RA
    9. Drosophila pseudoobscura pseudoobscura miR-219-RA
    10. Drosophila virilis miR-219-RA
    11. Drosophila yakuba miR-219-RA
    12. Equus caballus eca-miR-219-5p
    13. Gallus gallus gga-miR-219a
    14. Gorilla gorilla ggo-miR-219
    15. Macaca mulatta (Rhesus monkey) mml-miR-219
    16. Monodelphis domestica mdo-miR-219-5p
    17. Mus musculus (house mouse) mmu-miR-219a-5p
    18. Pan troglodytes ptr-miR-219-5p
    19. Pongo pygmaeus (Bornean orangutan) ppy-miR-219-5p
    20. Pteropus alecto pal-miR-219a-5p
    21. Rattus norvegicus rno-miR-219a-5p
    22. Tribolium castaneum tca-miR-219-5p
    23. Xenopus tropicalis (tropical clawed frog) xtr-miR-219
    Publications