v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-219-5p URS0000565C8D_7227

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAUUGUCCAAACGCAAUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-219-5p
  2. Branchiostoma floridae bfl-miR-219
  3. Canis lupus familiaris (dog) cfa-miR-219-5p
  4. Capitella teleta cte-miR-219
  5. Capra hircus chi-miR-219
  6. Drosophila erecta miR-219-RA
  7. Drosophila mojavensis miR-219-RA
  8. Drosophila pseudoobscura pseudoobscura miR-219-RA
  9. Drosophila virilis miR-219-RA
  10. Drosophila yakuba miR-219-RA
  11. Equus caballus (horse) eca-miR-219-5p
  12. Gallus gallus gga-miR-219a
  13. Gorilla gorilla gorilla ggo-miR-219 (MIR219)
  14. Gorilla gorilla (western gorilla) ggo-miR-219
  15. Homo sapiens hsa-miR-219a-5p
  16. Macaca mulatta mml-miR-219
  17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-219-5p
  18. Mus musculus (house mouse) mmu-miR-219a-5p
  19. Pan troglodytes ptr-miR-219-5p
  20. Pongo pygmaeus (Bornean orangutan) ppy-miR-219
  21. Pteropus alecto pal-miR-219a-5p
  22. Rattus norvegicus (Norway rat) rno-miR-219a-5p
  23. Tribolium castaneum (red flour beetle) tca-miR-219-5p
  24. Xenopus tropicalis (tropical clawed frog) xtr-miR-219
 Relationships

Molecular Relationships

 Publications