Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-219a URS0000565C8D_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUUGUCCAAACGCAAUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Branchiostoma belcheri bbe-miR-219-5p
  2. Branchiostoma floridae (Florida lancelet) bfl-miR-219
  3. Canis lupus familiaris (dog) cfa-miR-219-5p
  4. Capitella teleta cte-miR-219
  5. Capra hircus (goat) chi-miR-219
  6. Drosophila erecta miR-219-RA
  7. Drosophila melanogaster dme-miR-219-5p
  8. Drosophila mojavensis miR-219-RA
  9. Drosophila pseudoobscura pseudoobscura miR-219-RA
  10. Drosophila virilis miR-219-RA
  11. Drosophila yakuba miR-219-RA
  12. Equus caballus eca-miR-219-5p
  13. Gorilla gorilla gorilla ggo-miR-219 (MIR219)
  14. Gorilla gorilla (western gorilla) ggo-miR-219
  15. Homo sapiens (human) hsa-miR-219a-5p
  16. Macaca mulatta mml-miR-219
  17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-219-5p
  18. Mus musculus mmu-miR-219a-5p
  19. Pan troglodytes (chimpanzee) ptr-miR-219-5p
  20. Pongo pygmaeus ppy-miR-219-5p
  21. Pteropus alecto pal-miR-219a-5p
  22. Rattus norvegicus rno-miR-219a-5p
  23. Tribolium castaneum tca-miR-219-5p
  24. Xenopus tropicalis (tropical clawed frog) xtr-miR-219
Publications