Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila erecta tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4) secondary structure diagram

Drosophila erecta tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4) URS0000543E67_7220

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGUCGGUGGUGUAAUGGUUAGCAUAGUUGCCUUCCAAGCAGUUGACCCGGGUUCGAUUCCCGGCCGACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Drosophila ananassae tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  2. Drosophila busckii tRNA
  3. Drosophila ficusphila tRNA
  4. Drosophila grimshawi tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  5. Drosophila gunungcola tRNA-OTHER
  6. Drosophila melanogaster transfer RNA:Glycine-TCC 1-3 (Dmel_CR31242, Dmel_CR31491, Dmel_CR31494, Dmel_CR31518)
  7. Drosophila mojavensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  8. Drosophila persimilis tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  9. Drosophila pseudoobscura pseudoobscura tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  10. Drosophila sechellia tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  11. Drosophila simulans tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  12. Drosophila virilis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  13. Drosophila willistoni tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  14. Drosophila yakuba tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  15. Glossina austeni (Tsetse fly) tRNA tRNA-Gly
  16. Glossina brevipalpis tRNA tRNA-Gly
  17. Glossina fuscipes fuscipes tRNA
  18. Glossina morsitans morsitans tRNA tRNA-Gly
  19. Glossina pallidipes (Tsetse fly) tRNA tRNA-Gly
  20. Glossina palpalis gambiensis tRNA tRNA-Gly
2D structure Publications