Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila busckii (Fruit fly) tRNA-Gly secondary structure diagram

Drosophila busckii (Fruit fly) tRNA-Gly URS0000543E67_30019

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGUCGGUGGUGUAAUGGUUAGCAUAGUUGCCUUCCAAGCAGUUGACCCGGGUUCGAUUCCCGGCCGACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Drosophila albomicans (Fruit fly) transfer RNA glycine (anticodon UCC)
  2. Drosophila ananassae tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  3. Drosophila arizonae (Fruit fly) tRNA-Gly
  4. Drosophila biarmipes (Fruit fly) transfer RNA glycine (anticodon UCC)
  5. Drosophila bipectinata (Fruit fly) tRNA-Gly
  6. Drosophila elegans (Fruit fly) tRNA-Gly
  7. Drosophila erecta tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  8. Drosophila eugracilis (Fruit fly) tRNA-Gly
  9. Drosophila ficusphila (Fruit fly) tRNA-Gly
  10. Drosophila grimshawi tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  11. Drosophila gunungcola (Fruit fly) transfer RNA glycine (anticodon UCC)
  12. Drosophila hydei (Fruit fly) tRNA-Gly
  13. Drosophila innubila (Fruit fly) tRNA-Gly
  14. Drosophila kikkawai (Fruit fly) tRNA-Gly
  15. Drosophila mauritiana (Fruit fly) tRNA-Gly
  16. Drosophila melanogaster transfer RNA:Glycine-TCC 1-3 (Dmel_CR31242, Dmel_CR31491, Dmel_CR31494, Dmel_CR31518)
  17. Drosophila miranda (Fruit fly) tRNA-Gly
  18. Drosophila mojavensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  19. Drosophila navojoa (Fruit fly) tRNA-Gly
  20. Drosophila persimilis tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  21. Drosophila pseudoobscura (Fruit fly) tRNA-Gly
  22. Drosophila pseudoobscura pseudoobscura tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  23. Drosophila rhopaloa (Fruit fly) tRNA-Gly
  24. Drosophila santomea (Fruit fly) tRNA-Gly
  25. Drosophila sechellia tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  26. Drosophila simulans tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  27. Drosophila subpulchrella (Fruit fly) tRNA-Gly
  28. Drosophila suzukii (Fruit fly) tRNA-Gly
  29. Drosophila takahashii (Fruit fly) tRNA-Gly
  30. Drosophila teissieri (Fruit fly) tRNA-Gly
  31. Drosophila virilis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  32. Drosophila willistoni tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  33. Drosophila yakuba tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  34. Glossina austeni (Tsetse fly) tRNA tRNA-Gly
  35. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Gly
  36. Glossina fuscipes fuscipes tRNA
  37. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gly
  38. Glossina pallidipes (Tsetse fly) tRNA tRNA-Gly
  39. Glossina palpalis gambiensis tRNA tRNA-Gly
  40. Scaptodrosophila lebanonensis tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications