v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila pseudoobscura pseudoobscura tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4) secondary structure diagram

Drosophila pseudoobscura pseudoobscura tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4) URS0000543E67_46245

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGUCGGUGGUGUAAUGGUUAGCAUAGUUGCCUUCCAAGCAGUUGACCCGGGUUCGAUUCCCGGCCGACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 46 other species

  1. Drosophila albomicans (Fruit fly) transfer RNA glycine (anticodon UCC)
  2. Drosophila ananassae tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  3. Drosophila arizonae (Fruit fly) tRNA-Gly
  4. Drosophila biarmipes (Fruit fly) transfer RNA glycine (anticodon UCC)
  5. Drosophila bipectinata (Pomace flies) transfer RNA glycine (anticodon UCC)
  6. Drosophila busckii (Fruit fly) tRNA-Gly
  7. Drosophila elegans (Pomace flies) tRNA-Gly
  8. Drosophila erecta tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  9. Drosophila eugracilis (Fruit fly) tRNA-Gly
  10. Drosophila ficusphila (Fruit fly) tRNA-Gly
  11. Drosophila grimshawi tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  12. Drosophila gunungcola (Fruit fly) transfer RNA glycine (anticodon UCC)
  13. Drosophila hydei (Fruit fly) tRNA-Gly
  14. Drosophila innubila (Fruit fly) tRNA-Gly
  15. Drosophila kikkawai (Pomace flies) transfer RNA glycine (anticodon UCC)
  16. Drosophila mauritiana (Fruit fly) tRNA-Gly
  17. Drosophila melanogaster transfer RNA:Glycine-TCC 1-3 (Dmel_CR31242, Dmel_CR31491, Dmel_CR31494, Dmel_CR31518)
  18. Drosophila miranda (Fruit fly) tRNA-Gly
  19. Drosophila mojavensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  20. Drosophila montana (Pomace flies) transfer RNA glycine (anticodon UCC)
  21. Drosophila nasuta (Pomace flies) transfer RNA glycine (anticodon UCC)
  22. Drosophila navojoa (Fruit fly) tRNA-Gly
  23. Drosophila novamexicana (Pomace flies) tRNA-Gly
  24. Drosophila persimilis tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  25. Drosophila pseudoobscura (Fruit fly) tRNA-Gly
  26. Drosophila rhopaloa (Fruit fly) tRNA-Gly
  27. Drosophila santomea (Fruit fly) tRNA-Gly
  28. Drosophila sechellia tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  29. Drosophila serrata (Pomace flies) tRNA-Gly
  30. Drosophila simulans tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  31. Drosophila subpulchrella (Fruit fly) tRNA-Gly
  32. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glycine (anticodon UCC)
  33. Drosophila suzukii (Pomace flies) transfer RNA glycine (anticodon UCC)
  34. Drosophila takahashii (Pomace flies) transfer RNA glycine (anticodon UCC)
  35. Drosophila teissieri (Fruit fly) tRNA-Gly
  36. Drosophila tropicalis (Pomace flies) transfer RNA glycine (anticodon UCC)
  37. Drosophila virilis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  38. Drosophila willistoni tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  39. Drosophila yakuba tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  40. Glossina austeni (Tsetse fly) tRNA tRNA-Gly
  41. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Gly
  42. Glossina fuscipes fuscipes tRNA
  43. Glossina fuscipes (Tsetse fly) tRNA-Gly
  44. Glossina morsitans morsitans tRNA tRNA-Gly
  45. Glossina pallidipes tRNA tRNA-Gly
  46. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Gly
  47. Scaptodrosophila lebanonensis tRNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications