Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-145-3p URS000052F380_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-145: Ssc-mir-145 is a specific type of miRNA that has been studied in various contexts. It has been found to have a CN of 3 in a particular study [PMC3555835]. In another study, ssc-mir-145 was found to target NP genes isolated at 35 different times [PMC5412334]. However, the interaction between ssc-mir-145 and NP genes was not predicted in another study, possibly due to different prediction tools and criteria [PMC5412334]. Ssc-mir-145 is also related to energy metabolism and has been validated by qPCR in individual samples [PMC4970254]. Phylogenetic analysis has shown that ssc-mir-145 is conserved among different species and has the closest distance with human, mouse, and rat [PMC3509333]. In a study on the expression profile of novel miRNAs in pig tissues, ssc-mir-145 was found to be expressed in all tissues [PMC3427155]. It was also found to be overexpressed in E. coli F18-sensitive individuals [PMC3427155]. Ssc-mir-145 is regulated by different transcription factors and targets multiple genes associated with inhibiting proliferation [PMC3427155] [PMC5796217]. It is one of the dominant expressed miRNAs in certain libraries, contributing to a significant proportion of total miRNAs [PMC3901342]. Ssc-mir-145 has also been implicated in the development of adipose tissue [PMC7912685]. Overall, ssc-mir-145 plays various roles across different contexts and exhibits conserved characteristics across species.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAUUCCUGGAAAUACUGUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-145
  2. Cervus elaphus (red deer) cel-miR-145*
  3. Chrysemys picta (Painted turtle) cpi-miR-145-3p
  4. Danio rerio (zebrafish) dre-miR-145-3p
  5. Gadus morhua gmo-miR-145-3p
  6. Homo sapiens hsa-miR-145-3p
  7. Mus musculus Mus_musculus piRNA piR-mmu-8134900
  8. Ophiophagus hannah (king cobra) oha-miR-145-3p
  9. Python bivittatus pbv-miR-145-3p
  10. Tor tambroides (Thai mahseer) miR-145-3p
  11. Xenopus laevis xla-miR-145-3p
Publications