Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8134900 URS000052F380_10090

• 22 nucleotides
• 2 databases (ENA, PirBase)
• Found in 11 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GGAUUCCUGGAAAUACUGUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-145
2. Cervus elaphus (red deer) cel-miR-145*
3. Chrysemys picta (Painted turtle) cpi-miR-145-3p
4. Danio rerio (zebrafish) dre-miR-145-3p
5. Gadus morhua gmo-miR-145-3p
6. Homo sapiens hsa-miR-145-3p
7. Ophiophagus hannah (king cobra) oha-miR-145-3p
8. Python bivittatus pbv-miR-145-3p
9. Sus scrofa ssc-miR-145-3p
10. Tor tambroides (Thai mahseer) miR-145-3p
11. Xenopus laevis xla-miR-145-3p

Download

• FASTA
• JSON