v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-145 URS000052F380_9417

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAUUCCUGGAAAUACUGUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cervus elaphus (red deer) cel-miR-145*
  2. Chrysemys picta (Painted turtle) cpi-miR-145-3p
  3. Danio rerio (zebrafish) dre-miR-145-3p
  4. Gadus morhua gmo-miR-145-3p
  5. Homo sapiens hsa-miR-145-3p
  6. Mus musculus Mus_musculus piRNA piR-mmu-8134900
  7. Ophiophagus hannah (king cobra) oha-miR-145-3p
  8. Python bivittatus pbv-miR-145-3p
  9. Sus scrofa ssc-miR-145-3p
  10. Tor tambroides (Thai mahseer) miR-145-3p
  11. Xenopus laevis xla-miR-145-3p