Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-145-3p URS000052F380_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, RefSeq, TarBase, GeneCards, ENA, LncBase, MirGeneDB, MalaCards). Described in 57 papers. Homo sapiens (human) hsa-miR-145-3p sequence is a product of hsa-miR-145-3p, miR-145-3p, MIR145, hsa-miR-145, miR-145 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 4EHP, ABHD2, ABP620, ACF7, AFTPH, ALDH7A1, ANO6, APRO1, ARHGAP10, ARHGAP21.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGAUUCCUGGAAAUACUGUUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Alligator mississippiensis Ami-Mir-145_3p* (star (passenger))
    2. Anolis carolinensis Aca-Mir-145_3p* (star (passenger))
    3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-145
    4. Bos taurus (cattle) Bta-Mir-145_3p* (star (passenger))
    5. Canis lupus familiaris (dog) Cfa-Mir-145_3p* (star (passenger))
    6. Cavia porcellus Cpo-Mir-145_3p* (star (passenger))
    7. Cervus elaphus (red deer) cel-miR-145*
    8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-145_3p* (star (passenger))
    9. Chrysemys picta (Painted turtle) cpi-miR-145-3p
    10. Columba livia Cli-Mir-145_3p* (star (passenger))
    11. Danio rerio dre-miR-145-3p
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-145_3p* (star (passenger))
    13. Gadus morhua gmo-miR-145-3p
    14. Gallus gallus (chicken) Gga-Mir-145_3p* (star (passenger))
    15. Macaca mulatta Mml-Mir-145_3p* (star (passenger))
    16. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-145_3p* (star (passenger))
    17. Mus musculus Mmu-Mir-145_3p* (star (passenger))
    18. Ophiophagus hannah oha-miR-145-3p
    19. Ornithorhynchus anatinus Oan-Mir-145_3p* (star (passenger))
    20. Oryctolagus cuniculus (rabbit) Ocu-Mir-145_3p* (star (passenger))
    21. Python bivittatus (Burmese python) pbv-miR-145-3p
    22. Rattus norvegicus (Norway rat) Rno-Mir-145_3p* (star (passenger))
    23. Sarcophilus harrisii Sha-Mir-145_3p* (star (passenger))
    24. Scyliorhinus torazame (cloudy catshark) Sto-Mir-145_3p* (star (passenger))
    25. Sus scrofa (pig) ssc-miR-145-3p
    26. Tor tambroides (Thai mahseer) miR-145-3p
    27. Xenopus laevis (African clawed frog) xla-miR-145-3p
    28. Xenopus tropicalis Xtr-Mir-145_3p* (star (passenger))