Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-148b-3p URS0000521626_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-148b: Ssc-mir-148b is a candidate miRNA disease marker that was identified in a study examining miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets [PMC4585011]. It is one of the 12 candidate miRNAs identified in the study, along with ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152 [PMC4585011]. Another study found that the expression patterns of ssc-mir148b were similar to those of other miRNAs such as sccmi-R148a and -126 [PMC3770649]. In this study as well as another one that used high-throughput sequencing to compare miRNA expression in pigs susceptible and resistant to E. coli F18 infection [PMC3427155], it was found that 11 miRNAs were upregulated in susceptible animals (including sccmi-R143 and -let7f) while one (sccmi-R152) was downregulated [PMC3427155]. Unfortunately, no commercial TaqMan miRNA assay kit is available for validating the expression of certain target miRNAs such as ssCmi-R30e and ssCmir148b [PMC3427155]. Additionally, another study found that ssCmir148b was disrupted along with ssCmir148a and ssCmi-R152 sites in HSPA1A [PMC3490867].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCAUCACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis Ami-Mir-148-P4_3p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-148b-3p
  3. Bos taurus (cattle) bta-miR-148b
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148b
  5. Callorhinchus milii eshark_mir-148_1
  6. Canis lupus familiaris (dog) cfa-miR-148b
  7. Capra hircus chi-miR-148b-3p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-148b-3p
  9. Cervus elaphus cel-miR-148b
  10. Chrysemys picta bellii Cpi-Mir-148-P4_3p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-148b-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-148b-3p
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148b-3p
  14. Echinops telfairi Ete-Mir-148-P4_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-148b-3p
  16. Gekko japonicus Gja-Mir-148-P4_3p (mature (guide))
  17. Homo sapiens (human) hsa-miR-148b-3p
  18. Latimeria chalumnae Lch-Mir-148-P4_3p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-148-P4_3p (mature (guide))
  20. Macaca mulatta mml-miR-148b-3p
  21. Microcaecilia unicolor Mun-Mir-148-P4_3p (mature (guide))
  22. Mus musculus (house mouse) mmu-miR-148b-3p
  23. Ophiophagus hannah (king cobra) oha-miR-148b
  24. Oryctolagus cuniculus (rabbit) ocu-miR-148b-3p
  25. Pan troglodytes ptr-miR-148b
  26. Pongo pygmaeus (Bornean orangutan) ppy-miR-148b
  27. Pteropus alecto pal-miR-148b-3p
  28. Python bivittatus (Burmese python) pbv-miR-148b-3p
  29. Rattus norvegicus (Norway rat) rno-miR-148b-3p
  30. Sarcophilus harrisii Sha-Mir-148-P4_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-148-P4_3p (mature (guide))
  32. Tupaia chinensis (Chinese tree shrew) tch-miR-148b-3p
  33. Xenopus laevis (African clawed frog) Xla-Mir-148-P4b_3p (mature (co-guide))
  34. Xenopus tropicalis (tropical clawed frog) xtr-miR-148b
Publications