Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-148b URS0000521626_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCAUCACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis Ami-Mir-148-P4_3p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-148b-3p
  3. Bos taurus (cattle) bta-miR-148b
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148b
  5. Callorhinchus milii eshark_mir-148_1
  6. Canis lupus familiaris (dog) cfa-miR-148b
  7. Capra hircus chi-miR-148b-3p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-148b-3p
  9. Cervus elaphus cel-miR-148b
  10. Chrysemys picta bellii Cpi-Mir-148-P4_3p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-148b-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-148b-3p
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148b-3p
  14. Echinops telfairi Ete-Mir-148-P4_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-148b-3p
  16. Gekko japonicus Gja-Mir-148-P4_3p (mature (guide))
  17. Homo sapiens (human) hsa-miR-148b-3p
  18. Latimeria chalumnae Lch-Mir-148-P4_3p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-148-P4_3p (mature (guide))
  20. Macaca mulatta mml-miR-148b-3p
  21. Microcaecilia unicolor Mun-Mir-148-P4_3p (mature (guide))
  22. Mus musculus (house mouse) mmu-miR-148b-3p
  23. Ophiophagus hannah (king cobra) oha-miR-148b
  24. Oryctolagus cuniculus (rabbit) ocu-miR-148b-3p
  25. Pan troglodytes ptr-miR-148b
  26. Pteropus alecto pal-miR-148b-3p
  27. Python bivittatus (Burmese python) pbv-miR-148b-3p
  28. Rattus norvegicus (Norway rat) rno-miR-148b-3p
  29. Sarcophilus harrisii Sha-Mir-148-P4_3p (mature (guide))
  30. Sphenodon punctatus Spt-Mir-148-P4_3p (mature (guide))
  31. Sus scrofa (pig) ssc-miR-148b-3p
  32. Tupaia chinensis (Chinese tree shrew) tch-miR-148b-3p
  33. Xenopus laevis (African clawed frog) Xla-Mir-148-P4b_3p (mature (co-guide))
  34. Xenopus tropicalis (tropical clawed frog) xtr-miR-148b