Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-148b URS0000521626_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-148b: Bta-mir-148b is a microRNA that has been found to be differentially expressed in various contexts. In a study comparing different cattle breeds, bta-mir-148b was identified as one of the miRNAs that showed differential expression between the Abondance and Normande breeds, as well as between the Charolais and Normande breeds [PMC7106649]. Another study found that bta-mir-148b was more abundant in extracellular vesicles (EVs) from the oviduct compared to those from the uterus, suggesting its potential role in favoring the implantation process [PMC9594899]. In human tumor cells, bta-mir-148b has been reported to be related to the suppression of proliferation, migration, and invasion [PMC9594899]. Furthermore, bta-mir-148b has been implicated in various biological processes and pathways. It has been found to target genes involved in antigen processing and presentation as well as allograft rejection pathways [PMC5617439]. In cows with metritis (uterine inflammation), bta-mir-148b was downregulated compared to healthy cows [PMC7832875]. Additionally, bta-mir-148b has been shown to potentially target the 3'UTR of bovine MHC-I heavy chain mRNA [PMC5801426]. Overall, these studies highlight the diverse roles and potential regulatory functions of bta-mir-148b in different biological contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCAUCACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis Ami-Mir-148-P4_3p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-148b-3p
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148b
  4. Callorhinchus milii eshark_mir-148_1
  5. Canis lupus familiaris (dog) cfa-miR-148b
  6. Capra hircus chi-miR-148b-3p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-148b-3p
  8. Cervus elaphus cel-miR-148b
  9. Chrysemys picta bellii Cpi-Mir-148-P4_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-148b-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-148b-3p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148b-3p
  13. Echinops telfairi Ete-Mir-148-P4_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-148b-3p
  15. Gekko japonicus Gja-Mir-148-P4_3p (mature (guide))
  16. Homo sapiens (human) hsa-miR-148b-3p
  17. Latimeria chalumnae Lch-Mir-148-P4_3p (mature (guide))
  18. Lepisosteus oculatus (spotted gar) Loc-Mir-148-P4_3p (mature (guide))
  19. Macaca mulatta mml-miR-148b-3p
  20. Microcaecilia unicolor Mun-Mir-148-P4_3p (mature (guide))
  21. Mus musculus (house mouse) mmu-miR-148b-3p
  22. Ophiophagus hannah (king cobra) oha-miR-148b
  23. Oryctolagus cuniculus (rabbit) ocu-miR-148b-3p
  24. Pan troglodytes ptr-miR-148b
  25. Pongo pygmaeus (Bornean orangutan) ppy-miR-148b
  26. Pteropus alecto pal-miR-148b-3p
  27. Python bivittatus (Burmese python) pbv-miR-148b-3p
  28. Rattus norvegicus (Norway rat) rno-miR-148b-3p
  29. Sarcophilus harrisii Sha-Mir-148-P4_3p (mature (guide))
  30. Sphenodon punctatus Spt-Mir-148-P4_3p (mature (guide))
  31. Sus scrofa (pig) ssc-miR-148b-3p
  32. Tupaia chinensis (Chinese tree shrew) tch-miR-148b-3p
  33. Xenopus laevis (African clawed frog) Xla-Mir-148-P4b_3p (mature (co-guide))
  34. Xenopus tropicalis (tropical clawed frog) xtr-miR-148b
Publications