Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7c-5p URS000050DE77_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, LncBase, ENA, miRBase, RefSeq, GeneCards, MirGeneDB, TarBase). Described in 63 papers. Homo sapiens (human) hsa-let-7c-5p sequence is a product of let-7c-5p, hsa-let-7c-5p, MIRLET7C, let-7, let-7c, hsa-let-7c genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 2'-PDE, 2610509L04Rik, 2HOR0202, 3-PAP, 3635, 3D3.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGGUAGUAGGUUGUAUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 54 other species

    1. Alligator mississippiensis ami-let-7c-5p
    2. Anolis carolinensis aca-let-7c-5p
    3. Bos taurus (cattle) bta-let-7c
    4. Callithrix jacchus cja-let-7c
    5. Canis lupus familiaris (dog) cfa-let-7c
    6. Capra hircus (goat) chi-let-7c-5p
    7. Cavia porcellus cpo-let-7c-5p
    8. Cervus elaphus (red deer) cel-let-7c
    9. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P1b_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-let-7c-5p
    11. Columba livia cli-let-7c-5p
    12. Danio rerio dre-let-7c-5p
    13. Daphnia pulex Dpu-Let-7_5p (mature (guide))
    14. Dasypus novemcinctus dno-let-7c-5p
    15. Daubentonia madagascariensis dma-let-7c
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1c_5p (mature (guide))
    17. Equus caballus (horse) eca-let-7c
    18. Gadus morhua gmo-let-7c-5p
    19. Gallus gallus (chicken) gga-let-7c-5p
    20. Gorilla gorilla microRNA let-7c
    21. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7c
    22. Hippoglossus hippoglossus (Atlantic halibut) hhi-let-7c
    23. Ictalurus punctatus ipu-let-7c
    24. Lagothrix lagotricha (brown woolly monkey) microRNA let-7c
    25. Macaca mulatta mml-let-7c-5p
    26. Macaca nemestrina microRNA let-7c
    27. Maylandia zebra mze-let-7c
    28. Microcebus murinus (gray mouse lemur) mmr-let-7c
    29. Mus musculus mmu-let-7c-5p
    30. Neolamprologus brichardi nbr-let-7c
    31. Nomascus leucogenys nle-let-7c
    32. Ophiophagus hannah oha-let-7c-5p
    33. Oreochromis niloticus (Nile tilapia) oni-let-7c
    34. Ornithorhynchus anatinus oan-let-7c-5p
    35. Oryctolagus cuniculus (rabbit) ocu-let-7c-5p
    36. Otolemur garnettii (small-eared galago) oga-let-7c
    37. Ovis aries oar-let-7c
    38. Pan paniscus ppa-let-7c
    39. Pan troglodytes (chimpanzee) ptr-let-7c
    40. Papio hamadryas (hamadryas baboon) pha-let-7c
    41. Paralichthys olivaceus (Japanese flounder) pol-let-7a-5p
    42. Pongo pygmaeus ppy-let-7c
    43. Pteropus alecto pal-let-7c-5p
    44. Pundamilia nyererei pny-let-7c
    45. Python bivittatus (Burmese python) pbv-let-7c-5p
    46. Rattus norvegicus (Norway rat) rno-let-7c-5p
    47. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7c
    48. Salmo salar ssa-let-7c-5p
    49. Sarcophilus harrisii Sha-Let-7-P1c_5p (mature (guide))
    50. Sus scrofa (pig) ssc-let-7c
    51. Taeniopygia guttata (zebra finch) tgu-let-7c-5p
    52. Tor tambroides (Thai mahseer) let-7c-5p
    53. Triops cancriformis tcf-let-7-5p
    54. Xenopus laevis (African clawed frog) xla-let-7c-5p
    55. Xenopus tropicalis xtr-let-7c