Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-542-3p URS00004F859B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-542: Hsa-mir-542 is a microRNA that has been found to have various roles in different types of cancer [PMC3738541]. It has been identified as a non-invasive blood biomarker for tumor monitoring and prognosis prediction in patients with osteosarcoma [32]. In addition, hsa-mir-542 has been shown to target CDK14, inhibiting the development of ovarian cancer [33]. It also inhibits the growth and invasion of colon cancer cells through the PI3K/AKT/survivin signaling pathway [34]. Furthermore, hsa-mir-542 has been found to affect the prognosis of lung adenocarcinoma (LUAD) by inhibiting the expression of TRIM56 [PMC7940991]. Another study found that hsa-mir-542 is negatively correlated with TRIM56 expression and associated with poor prognosis in LUAD patients [PMC7940991]. The overexpression of hsa-mir-542 has also been associated with poor prognosis in LUAD [PMC7940991]. In bladder cancer cells, hsa-mir-542 expression is downregulated and negatively correlated with survivin protein expression, leading to inhibition of proliferation [PMC8907292]. Hsa-mir-542 is identified as a hub microRNA in gene modules related to cancer development and progression [PMC7339803]. Additionally, it has been ranked among other microRNAs as having potential significance in cancer research [PMC3738541].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGACAGAUUGAUAACUGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus Bta-Mir-542_3p (mature (guide))
  2. Canis lupus familiaris (dog) cfa-miR-542
  3. Cavia porcellus (domestic guinea pig) cpo-miR-542-3p
  4. Cervus elaphus (red deer) cel-miR-542-3p
  5. Dasypus novemcinctus dno-miR-542-3p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-542_3p (mature (guide))
  7. Equus caballus eca-miR-542-3p
  8. Gorilla gorilla gorilla ggo-miR-542 (MIR542)
  9. Gorilla gorilla (western gorilla) ggo-miR-542
  10. Macaca mulatta (Rhesus monkey) mml-miR-542-3p
  11. Microcebus murinus (gray mouse lemur) mmr-miR-542
  12. Mus musculus mmu-miR-542-3p
  13. Nomascus leucogenys nle-miR-542
  14. Oryctolagus cuniculus ocu-miR-542-3p
  15. Pongo pygmaeus ppy-miR-542-3p
  16. Pteropus alecto (black flying fox) pal-miR-542-3p
  17. Rattus norvegicus rno-miR-542-3p
  18. Sus scrofa ssc-miR-542-3p
  19. Tupaia chinensis (Chinese tree shrew) tch-miR-542-3p
Publications