Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-542-3p URS00004F859B_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGACAGAUUGAUAACUGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus Bta-Mir-542_3p (mature (guide))
  2. Canis lupus familiaris (dog) cfa-miR-542
  3. Cavia porcellus (domestic guinea pig) cpo-miR-542-3p
  4. Cervus elaphus (red deer) cel-miR-542-3p
  5. Dasypus novemcinctus dno-miR-542-3p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-542_3p (mature (guide))
  7. Equus caballus eca-miR-542-3p
  8. Gorilla gorilla gorilla ggo-miR-542 (MIR542)
  9. Gorilla gorilla (western gorilla) ggo-miR-542
  10. Homo sapiens (human) hsa-miR-542-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-542-3p
  12. Microcebus murinus (gray mouse lemur) mmr-miR-542
  13. Nomascus leucogenys nle-miR-542
  14. Oryctolagus cuniculus ocu-miR-542-3p
  15. Pongo pygmaeus ppy-miR-542-3p
  16. Pteropus alecto (black flying fox) pal-miR-542-3p
  17. Rattus norvegicus rno-miR-542-3p
  18. Sus scrofa ssc-miR-542-3p
  19. Tupaia chinensis (Chinese tree shrew) tch-miR-542-3p
Publications