Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-454-3p URS00004F77ED_9258

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUGCAAUAUUGCUUAUAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Anolis carolinensis (green anole) aca-miR-454-3p
  2. Bos taurus bta-miR-454
  3. Capra hircus chi-miR-454-3p
  4. Cervus elaphus (red deer) cel-miR-454
  5. Chiloscyllium plagiosum microRNA cpl-miR-454-3p
  6. Equus caballus eca-miR-454
  7. Gadus morhua (Atlantic cod) gmo-miR-454-3p
  8. Gallus gallus (chicken) gga-miR-454-3p
  9. Homo sapiens (human) hsa-miR-454-3p
  10. Ictalurus punctatus ipu-miR-454b
  11. Macaca mulatta mml-miR-454-3p
  12. Nomascus leucogenys nle-miR-454
  13. Pan troglodytes ptr-miR-454
  14. Sarcophilus harrisii sha-miR-454
  15. Sus scrofa (pig) ssc-miR-454
  16. Taeniopygia guttata tgu-miR-454-3p
  17. Xenopus tropicalis (tropical clawed frog) xtr-miR-454-3p
Publications