Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-454

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-454 URS00004F77ED_61853

23 nucleotides
1 database (miRBase)
Found in 17 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAGUGCAAUAUUGCUUAUAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Anolis carolinensis aca-miR-454-3p
Bos taurus bta-miR-454
Capra hircus chi-miR-454-3p
Cervus elaphus (red deer) cel-miR-454
Chiloscyllium plagiosum microRNA cpl-miR-454-3p
Equus caballus eca-miR-454
Gadus morhua gmo-miR-454-3p
Gallus gallus (chicken) gga-miR-454-3p
Homo sapiens (human) hsa-miR-454-3p
Ictalurus punctatus ipu-miR-454b
Macaca mulatta (Rhesus monkey) mml-miR-454-3p
Ornithorhynchus anatinus oan-miR-454-3p
Pan troglodytes ptr-miR-454
Sarcophilus harrisii (Tasmanian devil) sha-miR-454
Sus scrofa ssc-miR-454
Taeniopygia guttata (zebra finch) tgu-miR-454-3p
Xenopus tropicalis xtr-miR-454-3p