Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-532 URS00004E8341_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-532: Bta-mir-532 is a functional miRNA that is abundant in three analyzed tissues and is conserved in humans [PMC6691986]. It has a low miRDeep2 score and lacks a significant randfold p value [PMC6691986]. Bta-mir-532, along with bta-miR-103 and bta-miR-155, shows high homology to human miRNAs [PMC9569736]. Bta-mir-532 is significantly more abundant in corn silage farms compared to grass silage farms [PMC9569736]. It also differs significantly between grazing and zero-grazing farms, with higher abundance in grazing farms [PMC9569736]. Bta-mir-532, along with bta-miR-155, bta-miR-103, and bta-miR-7863, shows significant differences between different dairy production systems [PMC9569736]. These miRNAs may play a role in cell differentiation in the mammary gland and regulate milk production [PMC9569736]. Bta-mir-532 has not been previously studied for its expression in milk [PMC9569736]. It has been associated with spermatogenesis along with other miRNAs such as bta-miR-204 and the bta-miR-34 family [PMC8647812] [PMC6083711] . A false precursor of bta-mir-532 predicted by miRDeep2 contains a short star miRNA, indicating a potential high false positive rate for short precursor-generated miRNAs[ PMC4029070].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUGCCUUGAGUGUAGGACCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Callithrix jacchus cja-miR-532
  2. Canis lupus familiaris cfa-miR-532
  3. Capra hircus (goat) chi-miR-532-5p
  4. Cavia porcellus cpo-miR-532-5p
  5. Cervus elaphus cel-miR-532
  6. Cricetulus griseus cgr-miR-532-5p
  7. Equus caballus (horse) eca-miR-532-5p
  8. Homo sapiens (human) hsa-miR-532-5p
  9. Macaca mulatta mml-miR-532-5p
  10. Microcebus murinus (gray mouse lemur) mmr-miR-532
  11. Mus musculus mmu-miR-532-5p
  12. Nomascus leucogenys nle-miR-532
  13. Papio hamadryas (hamadryas baboon) pha-miR-532
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-532-5p
  15. Sus scrofa ssc-miR-532-5p
  16. Tupaia chinensis (Chinese tree shrew) tch-miR-532-5p
Publications