Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-532-5p URS00004E8341_9925

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUGCCUUGAGUGUAGGACCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-532
  2. Callithrix jacchus cja-miR-532
  3. Canis lupus familiaris cfa-miR-532
  4. Cavia porcellus cpo-miR-532-5p
  5. Cervus elaphus cel-miR-532
  6. Cricetulus griseus cgr-miR-532-5p
  7. Equus caballus (horse) eca-miR-532-5p
  8. Homo sapiens (human) hsa-miR-532-5p
  9. Macaca mulatta mml-miR-532-5p
  10. Microcebus murinus (gray mouse lemur) mmr-miR-532
  11. Mus musculus mmu-miR-532-5p
  12. Nomascus leucogenys nle-miR-532
  13. Papio hamadryas (hamadryas baboon) pha-miR-532
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-532-5p
  15. Sus scrofa ssc-miR-532-5p
  16. Tupaia chinensis (Chinese tree shrew) tch-miR-532-5p
Publications