v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-32-5p URS00004C47FB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-32: Hsa-mir-32 is one of the significantly up-regulated miRNAs found in the study, along with hsa-miR-19a, hsa-miR-18b, hsa-miR-96, hsa-miR-183, hsa-miR-130b, hsa-miR-182, hsa-miR-18a, hsa-miR-375, hsa-miR-106a, hsa-miR-106b, hsa-miR-425, hsa-miR-17, hsa-miR-25, and has miRNA 93 and 200c [PMC5788610]. The study also found 13 significantly down-regulated miRNAs including has miRNA 100 and has miRNA 23a [PMC5788610]. Interestingly enough PHLPP2 along with has mir32 and has mir141 have been previously related to patient prognosis [PMC6295837].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUUGCACAUUACUAAGUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis ami-miR-32-5p
  2. Anolis carolinensis (green anole) aca-miR-32-5p
  3. Canis lupus familiaris Cfa-Mir-32_5p (mature (guide))
  4. Cervus elaphus (red deer) cel-miR-32
  5. Chrysemys picta bellii Cpi-Mir-32_5p (mature (guide))
  6. Chrysemys picta (Painted turtle) cpi-miR-32-5p
  7. Columba livia cli-miR-32-5p
  8. Dasypus novemcinctus dno-miR-32-5p
  9. Echinops telfairi Ete-Mir-32_5p (mature (guide))
  10. Equus caballus eca-miR-32
  11. Gallus gallus Gga-Mir-32_5p (mature (guide))
  12. Gekko japonicus Gja-Mir-32_5p (mature (guide))
  13. Macaca mulatta (Rhesus monkey) Mml-Mir-32_5p (mature (guide))
  14. Microcaecilia unicolor Mun-Mir-32_5p (mature (guide))
  15. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-32_5p (mature (guide))
  16. Mus musculus (house mouse) mmu-miR-32-5p
  17. Ornithorhynchus anatinus Oan-Mir-32_5p (mature (guide))
  18. Oryctolagus cuniculus (rabbit) ocu-miR-32-5p
  19. Python bivittatus Pbv-Mir-32_5p (mature (guide))
  20. Rattus norvegicus rno-miR-32-5p
  21. Sarcophilus harrisii Sha-Mir-32_5p (mature (guide))
  22. Sphenodon punctatus (tuatara) Spt-Mir-32_5p (mature (guide))
  23. Taeniopygia guttata (zebra finch) Tgu-Mir-32_5p (mature (guide))
  24. Tupaia chinensis (Chinese tree shrew) tch-miR-32-5p
  25. Xenopus laevis (African clawed frog) Xla-Mir-32_5p (mature (guide))
 Publications