Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-32_5p (mature (guide)) URS00004C47FB_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUUGCACAUUACUAAGUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis ami-miR-32-5p
  2. Anolis carolinensis (green anole) aca-miR-32-5p
  3. Cervus elaphus (red deer) cel-miR-32
  4. Chrysemys picta bellii Cpi-Mir-32_5p (mature (guide))
  5. Chrysemys picta (Painted turtle) cpi-miR-32-5p
  6. Columba livia cli-miR-32-5p
  7. Dasypus novemcinctus dno-miR-32-5p
  8. Echinops telfairi Ete-Mir-32_5p (mature (guide))
  9. Equus caballus eca-miR-32
  10. Gallus gallus Gga-Mir-32_5p (mature (guide))
  11. Gekko japonicus Gja-Mir-32_5p (mature (guide))
  12. Homo sapiens hsa-miR-32-5p
  13. Macaca mulatta (Rhesus monkey) Mml-Mir-32_5p (mature (guide))
  14. Microcaecilia unicolor Mun-Mir-32_5p (mature (guide))
  15. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-32_5p (mature (guide))
  16. Mus musculus (house mouse) mmu-miR-32-5p
  17. Ornithorhynchus anatinus Oan-Mir-32_5p (mature (guide))
  18. Oryctolagus cuniculus (rabbit) ocu-miR-32-5p
  19. Python bivittatus Pbv-Mir-32_5p (mature (guide))
  20. Rattus norvegicus rno-miR-32-5p
  21. Sarcophilus harrisii Sha-Mir-32_5p (mature (guide))
  22. Sphenodon punctatus (tuatara) Spt-Mir-32_5p (mature (guide))
  23. Taeniopygia guttata (zebra finch) Tgu-Mir-32_5p (mature (guide))
  24. Tupaia chinensis (Chinese tree shrew) tch-miR-32-5p
  25. Xenopus laevis (African clawed frog) Xla-Mir-32_5p (mature (guide))