Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-34-P2a_3p (mature (co-guide)) URS00004C43E8_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCACUAACUCCACUGCCAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus cja-miR-34b
  2. Cavia porcellus cpo-miR-34b-3p
  3. Cricetulus griseus (Chinese hamster) cgr-miR-34b-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34b-3p
  5. Equus caballus (horse) eca-miR-34b-3p
  6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-34b-3p
  7. Mus musculus mmu-miR-34b-3p
  8. Ornithorhynchus anatinus (platypus) oan-miR-34b-3p
  9. Oryctolagus cuniculus ocu-miR-34b-3p
  10. Rattus norvegicus rno-miR-34b-3p
Publications