Dasypus novemcinctus (nine-banded armadillo) dno-miR-34b-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-34b-3p URS00004C43E8_9361

22 nucleotides
1 database (miRBase)
Found in 10 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAUCACUAACUCCACUGCCAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Callithrix jacchus cja-miR-34b
Cavia porcellus cpo-miR-34b-3p
Cricetulus griseus cgr-miR-34b-3p
Equus caballus eca-miR-34b-3p
Homo sapiens Hsa-Mir-34-P2a_3p (mature (co-guide))
Monodelphis domestica (gray short-tailed opossum) mdo-miR-34b-3p
Mus musculus (house mouse) mmu-miR-34b-3p
Ornithorhynchus anatinus oan-miR-34b-3p
Oryctolagus cuniculus (rabbit) ocu-miR-34b-3p
Rattus norvegicus rno-miR-34b-3p