Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7g-5p URS00004AFF8D_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (MirGeneDB, RefSeq, TarBase, PirBase, miRBase, LncBase, ENA). Described in 30 papers. Mus musculus (house mouse) mmu-let-7g-5p sequence is a product of mmu-let-7g, let-7, let-7g-5p, mmu-let-7g-5p, let-7g, Mirlet7g genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007D13Rik, 0610007M19Rik, 0610010G05Rik, 0610010I20Rik, 0610011A13Rik, 0610011C19Rik, 0610011K02Rik, 0610011L13Rik, 0610012C09Rik, 0610012J02Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGGUAGUAGUUUGUACAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 37 other species

    1. Alligator mississippiensis (American alligator) ami-let-7g-5p
    2. Anolis carolinensis aca-let-7g
    3. Bos taurus bta-let-7g
    4. Callithrix jacchus cja-let-7g
    5. Canis lupus familiaris cfa-let-7g
    6. Capra hircus (goat) chi-let-7g-5p
    7. Cavia porcellus cpo-let-7g-5p
    8. Cervus elaphus (red deer) cel-let-7g
    9. Chrysemys picta bellii Cpi-Let-7-P2c3_5p (mature (guide))
    10. Chrysemys picta cpi-let-7g-5p
    11. Columba livia cli-let-7g-5p
    12. Cricetulus griseus cgr-let-7g-5p
    13. Dasypus novemcinctus (nine-banded armadillo) dno-let-7g-5p
    14. Daubentonia madagascariensis dma-let-7g
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2c3_5p (mature (guide))
    16. Equus caballus eca-let-7g
    17. Gallus gallus (chicken) Gga-Let-7-P2c3_5p (mature (guide))
    18. Homo sapiens hsa-let-7g-5p
    19. Macaca mulatta mml-let-7g-5p
    20. Microcebus murinus mmr-let-7g
    21. Monodelphis domestica Mdo-Let-7-P2c3_5p (mature (guide))
    22. Nomascus leucogenys nle-let-7g
    23. Ophiophagus hannah (king cobra) oha-let-7g-5p
    24. Ornithorhynchus anatinus oan-let-7g-5p
    25. Oryctolagus cuniculus (rabbit) ocu-let-7g-5p
    26. Otolemur garnettii (small-eared galago) oga-let-7g
    27. Pan paniscus ppa-let-7g
    28. Pan troglodytes ptr-let-7g
    29. Papio hamadryas (hamadryas baboon) pha-let-7g
    30. Pongo pygmaeus (Bornean orangutan) ppy-let-7g
    31. Pteropus alecto pal-let-7g-5p
    32. Python bivittatus (Burmese python) pbv-let-7g-5p
    33. Rattus norvegicus rno-let-7g-5p
    34. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P2c3_5p (mature (guide))
    35. Sus scrofa ssc-let-7g
    36. Taeniopygia guttata tgu-let-7g-5p
    37. Tupaia chinensis (Chinese tree shrew) tch-let-7g-5p
    38. Xenopus laevis xla-let-7g