v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-410 URS000047E765_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUAUAACACAGAUGGCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Bos taurus (domestic cattle) bta-miR-410
  2. Canis lupus familiaris cfa-miR-410
  3. Capra hircus (goat) chi-miR-410-3p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-410-3p
  5. Cervus elaphus cel-miR-410
  6. Cricetulus griseus cgr-miR-410-3p
  7. Dasypus novemcinctus dno-miR-410-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P33_3p (mature (guide))
  9. Equus caballus eca-miR-410
  10. Homo sapiens (human) hsa-miR-410-3p
  11. Loxodonta africana (African savanna elephant) Laf-Mir-154-P33_3p (mature (guide))
  12. Macaca mulatta mml-miR-410-3p
  13. Microcebus murinus mmr-miR-410
  14. Mus musculus mmu-miR-410-3p
  15. Nomascus leucogenys nle-miR-410
  16. Oryctolagus cuniculus ocu-miR-410-3p
  17. Otolemur garnettii oga-miR-410
  18. Ovis aries (sheep) oar-miR-410-3p
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-410
  20. Pan troglodytes ptr-miR-410
  21. Pongo abelii (Sumatran orangutan) Pab-Mir-154-P33_3p (mature (guide))
  22. Pongo pygmaeus ppy-miR-410
  23. Pteropus alecto pal-miR-410-3p
  24. Rattus norvegicus rno-miR-410-3p
  25. Sus scrofa (pig) ssc-mir258
 Relationships

Molecular Relationships