Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-410-3p URS000047E765_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAUAACACAGAUGGCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Bos taurus bta-miR-410
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-410
  3. Canis lupus familiaris cfa-miR-410
  4. Capra hircus (goat) chi-miR-410-3p
  5. Cavia porcellus cpo-miR-410-3p
  6. Cervus elaphus cel-miR-410
  7. Cricetulus griseus (Chinese hamster) cgr-miR-410-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P12_3p (mature (guide))
  9. Equus caballus eca-miR-410
  10. Homo sapiens hsa-miR-410-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-410-3p
  12. Microcebus murinus mmr-miR-410
  13. Mus musculus mmu-miR-410-3p
  14. Nomascus leucogenys nle-miR-410
  15. Oryctolagus cuniculus ocu-miR-410-3p
  16. Otolemur garnettii oga-miR-410
  17. Ovis aries oar-miR-410-3p
  18. Pan paniscus (pygmy chimpanzee) ppa-miR-410
  19. Pan troglodytes (chimpanzee) ptr-miR-410
  20. Pongo pygmaeus (Bornean orangutan) ppy-miR-410
  21. Pteropus alecto (black flying fox) pal-miR-410-3p
  22. Rattus norvegicus rno-miR-410-3p
  23. Sus scrofa (pig) ssc-mir258