Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-410 URS000047E765_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-410: Cfa-mir-410 is a mature miRNA that has been studied in various contexts [PMC5844969]. In a study by [PMC5844969], seventeen mature miRNAs, including cfa-mir-410, were validated by qRT-PCR. Another study found that cfa-mir-410 gene expression was upregulated in the intestinal cells of dogs infected with E. granulosus [PMC7480022]. Additionally, [PMC7480022] reported that cfa-mir-410 was present in the tissue of a normal dog. In an avian-like H5N1 canine influenza virus model, the expression of cfa-mir-410 was found to be decreased in lung and tracheal tissues [PMC7480022]. The expression of cfa-mir-410 and other miRNAs was also examined in different segments of the small intestine, with an increasing trend observed for cfa-let7g and a declining trend for cfa-miR-98, cfa-mir-410, and cfamiR-130b towards the distal segments [PMC7480022]. Furthermore, a statistically significant correlation between regional expression and worm burden was observed for cfa-miR-98, cfa-mir-410, and cfamiR130b [PMC7480022]. Overall, these studies provide insights into the expression patterns and potential roles of cfa-mir-410 in different biological contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAUAACACAGAUGGCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Bos taurus bta-miR-410
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-410
  3. Capra hircus (goat) chi-miR-410-3p
  4. Cavia porcellus cpo-miR-410-3p
  5. Cervus elaphus cel-miR-410
  6. Cricetulus griseus (Chinese hamster) cgr-miR-410-3p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-410-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P12_3p (mature (guide))
  9. Equus caballus eca-miR-410
  10. Homo sapiens hsa-miR-410-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-410-3p
  12. Microcebus murinus mmr-miR-410
  13. Mus musculus mmu-miR-410-3p
  14. Nomascus leucogenys nle-miR-410
  15. Oryctolagus cuniculus ocu-miR-410-3p
  16. Otolemur garnettii oga-miR-410
  17. Ovis aries oar-miR-410-3p
  18. Pan paniscus (pygmy chimpanzee) ppa-miR-410
  19. Pan troglodytes (chimpanzee) ptr-miR-410
  20. Pongo pygmaeus (Bornean orangutan) ppy-miR-410
  21. Pteropus alecto (black flying fox) pal-miR-410-3p
  22. Rattus norvegicus rno-miR-410-3p
  23. Sus scrofa (pig) ssc-mir258
Publications