Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles albimanus (Mosquito) tRNA tRNA-Phe secondary structure diagram

Anopheles albimanus (Mosquito) tRNA tRNA-Phe URS0000454282_7167

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCCGGUUCAAUCCCGGGUUUCGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Aedes aegypti tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  2. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Phe
  3. Agrilus planipennis (Emerald ash borer) tRNA-Phe
  4. Amyelois transitella (Moths) transfer RNA phenylalanine (anticodon GAA)
  5. Anopheles arabiensis (Mosquito) tRNA tRNA-Phe
  6. Anopheles atroparvus tRNA
  7. Anopheles christyi (Mosquito) tRNA tRNA-Phe
  8. Anopheles coluzzii tRNA-Phe for anticodon GAA
  9. Anopheles culicifacies (Mosquito) tRNA tRNA-Phe
  10. Anopheles darlingi tRNA ADAC010870
  11. Anopheles dirus (Mosquito) tRNA tRNA-Phe
  12. Anopheles epiroticus (Mosquito) tRNA tRNA-Phe
  13. Anopheles farauti tRNA tRNA-Phe
  14. Anopheles funestus (African malaria mosquito) tRNA-Phe for anticodon GAA
  15. Anopheles gambiae (African malaria mosquito) tRNA
  16. Anopheles gambiae str. PEST tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  17. Anopheles maculatus tRNA tRNA-Phe
  18. Anopheles melas tRNA tRNA-Phe
  19. Anopheles merus (Mosquito) tRNA tRNA-Phe
  20. Anopheles minimus tRNA tRNA-Phe
  21. Anopheles quadriannulatus tRNA tRNA-Phe
  22. Anopheles sinensis (Mosquito) tRNA tRNA-Phe
  23. Anopheles stephensi tRNA tRNA-Phe
  24. Apis cerana cerana tRNA
  25. Apis dorsata (Giant honeybee) tRNA-Phe
  26. Apis florea tRNA-Phe
  27. Apis mellifera tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  28. Asbolus verrucosus (desert ironclad beetle) tRNA
  29. Bactrocera dorsalis (Oriental fruit fly) transfer RNA phenylalanine (anticodon GAA)
  30. Bactrocera latifrons (Solanum fruit fly) tRNA-Phe
  31. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA phenylalanine (anticodon GAA)
  32. Bactrocera oleae (Olive fruit fly) tRNA-Phe
  33. Bactrocera tryoni tRNA-Phe
  34. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026431.1
  35. Bombyx mandarina tRNA-Phe
  36. Bombyx mori tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 5)
  37. Brenthis ino (lesser marbled fritillary) tRNA
  38. Cephus cinctus (wheat stem sawfly) tRNA
  39. Ceratitis capitata tRNA-Phe
  40. Chironomus riparius tRNA
  41. Chrysodeixis includens tRNA
  42. Clarias magur (asian catfish) tRNA
  43. Clunio marinus tRNA
  44. Copidosoma floridanum tRNA-Phe
  45. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015348.1
  46. Cydia pomonella (The codling moth) transfer RNA phenylalanine (anticodon GAA)
  47. Danaus chrysippus (African queen) tRNA
  48. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018432.1
  49. Danaus plexippus plexippus (Monarch butterfly) tRNA-Phe
  50. Danionella cerebrum tRNA-Phe
  51. Danionella translucida tRNA
  52. Diatraea saccharalis (sugarcane borer) tRNA
  53. Drosophila albomicans (Fruit fly) transfer RNA phenylalanine (anticodon GAA)
  54. Drosophila ananassae tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  55. Drosophila arizonae (Fruit fly) tRNA-Phe
  56. Drosophila biarmipes (Fruit fly) transfer RNA phenylalanine (anticodon GAA)
  57. Drosophila bipectinata (Pomace flies) transfer RNA phenylalanine (anticodon GAA)
  58. Drosophila busckii (Fruit fly) tRNA-Phe
  59. Drosophila elegans (Pomace flies) tRNA-Phe
  60. Drosophila erecta tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  61. Drosophila eugracilis (Fruit fly) tRNA-Phe
  62. Drosophila ficusphila (Fruit fly) tRNA-Phe
  63. Drosophila grimshawi tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  64. Drosophila guanche (Fruit fly) tRNA-Phe
  65. Drosophila gunungcola (Fruit fly) transfer RNA phenylalanine (anticodon GAA)
  66. Drosophila hydei (Fruit fly) tRNA-Phe
  67. Drosophila innubila (Fruit fly) tRNA-Phe
  68. Drosophila kikkawai (Pomace flies) transfer RNA phenylalanine (anticodon GAA)
  69. Drosophila mauritiana (Fruit fly) tRNA-Phe
  70. Drosophila melanogaster (fruit fly) transfer RNA:Phenylalanine-GAA 1-5 (multiple genes)
  71. Drosophila miranda (Fruit fly) tRNA-Phe
  72. Drosophila mojavensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  73. Drosophila montana (Pomace flies) transfer RNA phenylalanine (anticodon GAA)
  74. Drosophila nasuta (Pomace flies) transfer RNA phenylalanine (anticodon GAA)
  75. Drosophila navojoa (Fruit fly) tRNA-Phe
  76. Drosophila novamexicana (Pomace flies) tRNA-Phe
  77. Drosophila obscura (Fruit fly) tRNA-Phe
  78. Drosophila persimilis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  79. Drosophila pseudoobscura (Fruit fly) tRNA-Phe
  80. Drosophila pseudoobscura pseudoobscura tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 7)
  81. Drosophila rhopaloa (Fruit fly) tRNA-Phe
  82. Drosophila santomea (Fruit fly) tRNA-Phe
  83. Drosophila sechellia tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  84. Drosophila serrata (Pomace flies) tRNA-Phe
  85. Drosophila simulans tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  86. Drosophila subobscura (Fruit fly) tRNA-Phe
  87. Drosophila subpulchrella (Fruit fly) tRNA-Phe
  88. Drosophila sulfurigaster albostrigata (Flies) transfer RNA phenylalanine (anticodon GAA)
  89. Drosophila suzukii (Pomace flies) transfer RNA phenylalanine (anticodon GAA)
  90. Drosophila takahashii (Pomace flies) transfer RNA phenylalanine (anticodon GAA)
  91. Drosophila teissieri (Fruit fly) tRNA-Phe
  92. Drosophila tropicalis (Pomace flies) transfer RNA phenylalanine (anticodon GAA)
  93. Drosophila virilis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  94. Drosophila willistoni tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  95. Drosophila yakuba tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  96. Eumeta japonica tRNA
  97. Galleria mellonella (greater wax moth) tRNA
  98. Glossina austeni tRNA tRNA-Phe
  99. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Phe
  100. Glossina fuscipes fuscipes tRNA
  101. Glossina fuscipes (Tsetse fly) tRNA-Phe
  102. Glossina morsitans morsitans tRNA tRNA-Phe
  103. Glossina pallidipes tRNA tRNA-Phe
  104. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Phe
  105. Heliconius melpomene tRNA HMEL011962
  106. Helicoverpa armigera (Cotton bollworm) transfer RNA phenylalanine (anticodon GAA)
  107. Helicoverpa zea tRNA-Phe
  108. Heliothis virescens (tobacco budworm) tRNA
  109. Hermetia illucens tRNA-Phe
  110. Ignelater luminosus (cucubano) tRNA
  111. Leguminivora glycinivorella (Soybean pod borer) tRNA-Phe
  112. Leptidea sinapis tRNA
  113. Lucilia cuprina (Australian sheep blowfly) tRNA-Phe for anticodon GAA
  114. Lucilia sericata (Common green bottle fly) tRNA-Phe
  115. Lutzomyia longipalpis tRNA tRNA-Phe
  116. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011435.1
  117. Manduca sexta tRNA-Phe
  118. Megaselia scalaris (Coffin fly) tRNA-Phe for anticodon GAA
  119. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023692.1
  120. Musca domestica (House fly) transfer RNA phenylalanine (anticodon GAA)
  121. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013587.1
  122. Octopus bimaculoides (California two-spot octopus) transfer RNA phenylalanine (anticodon GAA)
  123. Octopus sinensis (East Asian common octopus) tRNA-Phe
  124. Octopus vulgaris (common octopus) tRNA
  125. Onthophagus taurus (Dung beetle) tRNA-Phe
  126. Orussus abietinus (Parasitic wood wasp) tRNA-Phe
  127. Oryctes borbonicus tRNA
  128. Papilio machaon tRNA
  129. Papilio xuthus tRNA
  130. Pararge aegeria aegeria tRNA
  131. Pararge aegeria tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 3)
  132. Arctia plantaginis Parasemia plantaginis tRNA
  133. Parnassius apollo (apollo) tRNA
  134. Pectinophora gossypiella (Pink bollworm) transfer RNA phenylalanine (anticodon GAA)
  135. Phlebotomus argentipes (Sand fly) transfer RNA phenylalanine (anticodon GAA)
  136. Phlebotomus papatasi (Sand fly) tRNA tRNA-Phe
  137. Photinus pyralis (Common eastern firefly) tRNA-Phe
  138. Phthorimaea operculella tRNA-Phe
  139. Pieris brassicae (large cabbage white) tRNA
  140. Pieris macdunnoughi tRNA
  141. Plodia interpunctella (Indianmeal moth) transfer RNA phenylalanine (anticodon GAA)
  142. Plutella xylostella tRNA
  143. Polypedilum vanderplanki (sleeping chironomid) tRNA
  144. Rhagoletis pomonella tRNA-Phe
  145. Rhynchophorus ferrugineus (red palm weevil) tRNA
  146. Scaptodrosophila lebanonensis tRNA
  147. Acanthosepion pharaonis Sepia pharaonis tRNA
  148. Sergentomyia squamirostris tRNA-Phe
  149. Spodoptera exigua (beet armyworm) tRNA
  150. Spodoptera frugiperda tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 11)
  151. Spodoptera littoralis tRNA
  152. Spodoptera litura tRNA
  153. Stomoxys calcitrans (stable fly) transfer RNA phenylalanine (anticodon GAA)
  154. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Phe
  155. Tenebrio molitor (yellow mealworm) tRNA
  156. Tribolium castaneum (Red flour beetle) transfer RNA phenylalanine (anticodon GAA)
  157. Tribolium madens (Black flour beetle) tRNA-Phe
  158. Trichoplusia ni (cabbage looper) tRNA
  159. Uranotaenia lowii (Mosquitos) transfer RNA phenylalanine (anticodon GAA)
  160. Vanessa tameamea tRNA
  161. Zerene cesonia tRNA-Phe
  162. Zeugodacus cucurbitae (Melon fly) transfer RNA phenylalanine (anticodon GAA)
  163. Zophobas morio tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications