Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila persimilis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6) secondary structure diagram

Drosophila persimilis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6) URS0000454282_7234

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCCGGUUCAAUCCCGGGUUUCGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 88 other species

  1. Aedes aegypti (Yellow fever mosquito) tRNA AAEL016853
  2. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Phe
  3. Agrilus planipennis tRNA-Phe
  4. Amyelois transitella (Naval orange worm) tRNA-Phe
  5. Anopheles albimanus (Mosquito) tRNA tRNA-Phe
  6. Anopheles arabiensis (Mosquito) tRNA tRNA-Phe
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA tRNA-Phe
  9. Anopheles coluzzii (Mosquito) tRNA-Phe for anticodon GAA
  10. Anopheles culicifacies (Mosquito) tRNA tRNA-Phe
  11. Anopheles darlingi (American malaria mosquito) tRNA ADAC010870
  12. Anopheles dirus (Mosquito) tRNA tRNA-Phe
  13. Anopheles epiroticus tRNA tRNA-Phe
  14. Anopheles farauti (Mosquito) tRNA tRNA-Phe
  15. Anopheles funestus tRNA-Phe for anticodon GAA
  16. Anopheles gambiae tRNA
  17. Anopheles gambiae str. PEST tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  18. Anopheles maculatus (Mosquito) tRNA tRNA-Phe
  19. Anopheles melas tRNA tRNA-Phe
  20. Anopheles merus (Mosquito) tRNA tRNA-Phe
  21. Anopheles minimus (Mosquito) tRNA tRNA-Phe
  22. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Phe
  23. Anopheles sinensis tRNA tRNA-Phe
  24. Anopheles stephensi tRNA tRNA-Phe
  25. Apis dorsata tRNA-Phe
  26. Apis florea tRNA-Phe
  27. Apis mellifera tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  28. Bactrocera dorsalis (Oriental fruit fly) tRNA-Phe
  29. Bactrocera latifrons tRNA-Phe
  30. Bactrocera tryoni tRNA-Phe
  31. Bicyclus anynana (Squinting bush brown) tRNA-Phe
  32. Bombyx mandarina tRNA-Phe
  33. Bombyx mori tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 5)
  34. Ceratitis capitata (Mediterranean fruit fly) tRNA-Phe
  35. Clunio marinus tRNA
  36. Copidosoma floridanum (Parasitoid wasp) tRNA-Phe
  37. Danaus plexippus plexippus tRNA
  38. Danionella translucida tRNA-Phe
  39. Drosophila ananassae tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  40. Drosophila busckii tRNA
  41. Drosophila erecta tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  42. Drosophila ficusphila tRNA
  43. Drosophila grimshawi tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  44. Drosophila guanche tRNA.Phe
  45. Drosophila gunungcola tRNA-OTHER
  46. Drosophila melanogaster (fruit fly) transfer RNA:Phenylalanine-GAA 1-5 (multiple genes)
  47. Drosophila mojavensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  48. Drosophila pseudoobscura pseudoobscura tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 7)
  49. Drosophila sechellia tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  50. Drosophila simulans tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  51. Drosophila virilis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  52. Drosophila willistoni tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  53. Drosophila yakuba tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  54. Eumeta japonica tRNA-Phe
  55. Galleria mellonella tRNA-Phe
  56. Glossina austeni (Tsetse fly) tRNA tRNA-Phe
  57. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Phe
  58. Glossina fuscipes fuscipes tRNA
  59. Glossina morsitans morsitans tRNA tRNA-Phe
  60. Glossina pallidipes (Tsetse fly) tRNA tRNA-Phe
  61. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Phe
  62. Heliconius melpomene tRNA HMEL011962
  63. Helicoverpa armigera transfer RNA phenylalanine (anticodon GAA)
  64. Helicoverpa zea tRNA-Phe
  65. Hermetia illucens tRNA-Phe
  66. Leguminivora glycinivorella tRNA-Phe
  67. Lucilia cuprina (Australian sheep blowfly) tRNA-Phe for anticodon GAA
  68. Lutzomyia longipalpis tRNA tRNA-Phe
  69. Manduca sexta tRNA-Phe
  70. Megaselia scalaris tRNA-Phe for anticodon GAA
  71. Melitaea cinxia misc RNA ENSMCXG00005023692.1
  72. Musca domestica (House fly) tRNA MDOA001873
  73. Octopus bimaculoides tRNA-Phe
  74. Octopus sinensis tRNA-Phe
  75. Onthophagus taurus (Dung beetle) tRNA-Phe
  76. Orussus abietinus (Parasitic wood wasp) tRNA-Phe
  77. Oryctes borbonicus tRNA
  78. Papilio machaon tRNA
  79. Papilio xuthus tRNA
  80. Pararge aegeria tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 3)
  81. Pectinophora gossypiella transfer RNA phenylalanine (anticodon GAA)
  82. Phlebotomus papatasi tRNA tRNA-Phe
  83. Plutella xylostella tRNA-Phe
  84. Rhagoletis pomonella (Apple magot fly) tRNA-Phe
  85. Spodoptera frugiperda tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 11)
  86. Stomoxys calcitrans tRNA-Phe
  87. Tribolium castaneum tRNA-Phe for anticodon GAA
  88. Zerene cesonia (Southern Dogface) tRNA-Phe
2D structure Publications