Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chironomus riparius tRNA secondary structure diagram

Chironomus riparius tRNA URS0000454282_315576

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCCGGUUCAAUCCCGGGUUUCGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 148 other species

  1. Aedes aegypti (Yellow fever mosquito) tRNA AAEL016853
  2. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Phe
  3. Agrilus planipennis tRNA-Phe
  4. Amyelois transitella tRNA-Phe
  5. Anopheles albimanus (Mosquito) tRNA tRNA-Phe
  6. Anopheles arabiensis (Mosquito) tRNA tRNA-Phe
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi (Mosquito) tRNA tRNA-Phe
  9. Anopheles coluzzii (Mosquito) tRNA-Phe for anticodon GAA
  10. Anopheles culicifacies (Mosquito) tRNA tRNA-Phe
  11. Anopheles darlingi tRNA ADAC010870
  12. Anopheles dirus (Mosquito) tRNA tRNA-Phe
  13. Anopheles epiroticus (Mosquito) tRNA tRNA-Phe
  14. Anopheles farauti (Mosquito) tRNA tRNA-Phe
  15. Anopheles funestus (African malaria mosquito) tRNA-Phe for anticodon GAA
  16. Anopheles gambiae (African malaria mosquito) tRNA
  17. Anopheles gambiae str. PEST tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  18. Anopheles maculatus tRNA tRNA-Phe
  19. Anopheles melas (Mosquito) tRNA tRNA-Phe
  20. Anopheles merus (Mosquito) tRNA tRNA-Phe
  21. Anopheles minimus tRNA tRNA-Phe
  22. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Phe
  23. Anopheles sinensis (Mosquito) tRNA tRNA-Phe
  24. Anopheles stephensi tRNA tRNA-Phe
  25. Apis cerana cerana tRNA
  26. Apis dorsata (Giant honeybee) tRNA-Phe
  27. Apis florea (Dwarf honeybee) tRNA-Phe
  28. Apis mellifera tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  29. Asbolus verrucosus (desert ironclad beetle) tRNA
  30. Bactrocera dorsalis tRNA-Phe
  31. Bactrocera latifrons tRNA-Phe
  32. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA phenylalanine (anticodon GAA)
  33. Bactrocera tryoni tRNA-Phe
  34. Bicyclus anynana tRNA-Phe
  35. Bombyx mandarina tRNA-Phe
  36. Bombyx mori tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 5)
  37. Brenthis ino (lesser marbled fritillary) tRNA
  38. Cephus cinctus (wheat stem sawfly) tRNA
  39. Ceratitis capitata (Mediterranean fruit fly) tRNA-Phe
  40. Chrysodeixis includens tRNA
  41. Clarias magur (asian catfish) tRNA
  42. Clunio marinus tRNA
  43. Copidosoma floridanum tRNA-Phe
  44. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015348.1
  45. Danaus chrysippus (African queen) tRNA
  46. Danaus plexippus plexippus tRNA
  47. Danionella cerebrum tRNA-Phe
  48. Danionella translucida tRNA
  49. Diatraea saccharalis (sugarcane borer) tRNA
  50. Drosophila albomicans (Fruit fly) transfer RNA phenylalanine (anticodon GAA)
  51. Drosophila ananassae tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  52. Drosophila arizonae (Fruit fly) tRNA-Phe
  53. Drosophila biarmipes (Fruit fly) transfer RNA phenylalanine (anticodon GAA)
  54. Drosophila bipectinata (Fruit fly) tRNA-Phe
  55. Drosophila busckii (Fruit fly) tRNA-Phe
  56. Drosophila elegans (Fruit fly) tRNA-Phe
  57. Drosophila erecta tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  58. Drosophila eugracilis (Fruit fly) tRNA-Phe
  59. Drosophila ficusphila (Fruit fly) tRNA-Phe
  60. Drosophila grimshawi tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  61. Drosophila guanche (Fruit fly) tRNA-Phe
  62. Drosophila gunungcola (Fruit fly) transfer RNA phenylalanine (anticodon GAA)
  63. Drosophila hydei (Fruit fly) tRNA-Phe
  64. Drosophila innubila (Fruit fly) tRNA-Phe
  65. Drosophila kikkawai (Fruit fly) tRNA-Phe
  66. Drosophila mauritiana (Fruit fly) tRNA-Phe
  67. Drosophila melanogaster transfer RNA:Phenylalanine-GAA 1-5 (multiple genes)
  68. Drosophila miranda (Fruit fly) tRNA-Phe
  69. Drosophila mojavensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  70. Drosophila navojoa (Fruit fly) tRNA-Phe
  71. Drosophila obscura (Fruit fly) tRNA-Phe
  72. Drosophila persimilis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  73. Drosophila pseudoobscura (Fruit fly) tRNA-Phe
  74. Drosophila pseudoobscura pseudoobscura tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 7)
  75. Drosophila rhopaloa (Fruit fly) tRNA-Phe
  76. Drosophila santomea (Fruit fly) tRNA-Phe
  77. Drosophila sechellia tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  78. Drosophila simulans tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  79. Drosophila subobscura (Fruit fly) tRNA-Phe
  80. Drosophila subpulchrella (Fruit fly) tRNA-Phe
  81. Drosophila suzukii (Fruit fly) tRNA-Phe
  82. Drosophila takahashii (Fruit fly) tRNA-Phe
  83. Drosophila teissieri (Fruit fly) tRNA-Phe
  84. Drosophila virilis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
  85. Drosophila willistoni tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  86. Drosophila yakuba tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  87. Eumeta japonica tRNA
  88. Galleria mellonella (Greater wax moth) tRNA-Phe
  89. Glossina austeni tRNA tRNA-Phe
  90. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Phe
  91. Glossina fuscipes fuscipes tRNA
  92. Glossina morsitans morsitans tRNA tRNA-Phe
  93. Glossina pallidipes (Tsetse fly) tRNA tRNA-Phe
  94. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Phe
  95. Heliconius melpomene (Postman butterfly) tRNA HMEL011962
  96. Helicoverpa armigera transfer RNA phenylalanine (anticodon GAA)
  97. Helicoverpa zea (Corn earworm) tRNA-Phe
  98. Heliothis virescens (tobacco budworm) tRNA
  99. Hermetia illucens tRNA-Phe
  100. Ignelater luminosus (cucubano) tRNA
  101. Leguminivora glycinivorella (Soybean pod borer) tRNA-Phe
  102. Leptidea sinapis tRNA
  103. Lucilia cuprina tRNA-Phe for anticodon GAA
  104. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Phe
  105. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011435.1
  106. Manduca sexta (Tobacco hornworm) tRNA-Phe
  107. Megaselia scalaris (Coffin fly) tRNA-Phe for anticodon GAA
  108. Melitaea cinxia misc RNA ENSMCXG00005023692.1
  109. Musca domestica tRNA MDOA001873
  110. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013126.1
  111. Octopus bimaculoides (California two-spot octopus) transfer RNA phenylalanine (anticodon GAA)
  112. Octopus sinensis tRNA-Phe
  113. Octopus vulgaris (common octopus) tRNA
  114. Onthophagus taurus (Dung beetle) tRNA-Phe
  115. Orussus abietinus tRNA-Phe
  116. Oryctes borbonicus tRNA
  117. Papilio machaon tRNA
  118. Papilio xuthus tRNA
  119. Pararge aegeria aegeria tRNA
  120. Pararge aegeria tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 3)
  121. Arctia plantaginis Parasemia plantaginis tRNA
  122. Parnassius apollo (apollo) tRNA
  123. Pectinophora gossypiella transfer RNA phenylalanine (anticodon GAA)
  124. Phlebotomus argentipes (Sand fly) transfer RNA phenylalanine (anticodon GAA)
  125. Phlebotomus papatasi (Sand fly) tRNA tRNA-Phe
  126. Photinus pyralis (common eastern firefly) tRNA
  127. Pieris brassicae (large cabbage white) tRNA
  128. Pieris macdunnoughi tRNA
  129. Plodia interpunctella (Indianmeal moth) transfer RNA phenylalanine (anticodon GAA)
  130. Plutella xylostella (diamondback moth) tRNA
  131. Polypedilum vanderplanki (sleeping chironomid) tRNA
  132. Rhagoletis pomonella tRNA-Phe
  133. Rhynchophorus ferrugineus (red palm weevil) tRNA
  134. Scaptodrosophila lebanonensis tRNA
  135. Acanthosepion pharaonis Sepia pharaonis tRNA
  136. Sergentomyia squamirostris tRNA-Phe
  137. Spodoptera exigua (beet armyworm) tRNA
  138. Spodoptera frugiperda tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 11)
  139. Spodoptera littoralis tRNA
  140. Spodoptera litura tRNA
  141. Stomoxys calcitrans (Stable fly) tRNA-Phe
  142. Tenebrio molitor (yellow mealworm) tRNA
  143. Tribolium castaneum tRNA-Phe for anticodon GAA
  144. Tribolium madens (Black flour beetle) tRNA-Phe
  145. Trichoplusia ni (cabbage looper) tRNA
  146. Uranotaenia lowii (Mosquitos) transfer RNA phenylalanine (anticodon GAA)
  147. Vanessa tameamea tRNA
  148. Zerene cesonia tRNA-Phe
  149. Zeugodacus cucurbitae (Melon fly) transfer RNA phenylalanine (anticodon GAA)
  150. Zophobas morio tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...