Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-106b-5p URS00004449AE_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, MalaCards, IntAct, GeneCards, MirGeneDB, PSICQUIC, TarBase, miRBase, RefSeq, ENA). Described in 94 papers. Homo sapiens (human) hsa-miR-106b-5p sequence is a product of miR-106, miR-106b-5p, miR-106b, MIR106B, hsa-miR-106b-5p, hsa-miR-106b genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 11B6, 14-3-3-zeta, 1700010H15RiK, 182-FIP, 2'-PDE, 20D7-FC4, 2700066J21Rik, 3-10C.

Interactions 31

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-106b-5p interacts with:

Interaction id Participant Synonyms
EBI-22267323 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-24811374 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-21019170 intact:EBI-21019154 EBI-21019154 ENST00000227507 mrna_ccnd1
EBI-25297517 URS0000739F2B_9606 EBI-25297168 HGNC:9589 URS0000739F2B_9606 pten1p_pseudogene
EBI-25297539 URS0000739F2B_9606 EBI-25297168 HGNC:9589 URS0000739F2B_9606 pten1p_pseudogene
URS00004449AE_9606-0 P06241 P06241
URS00004449AE_9606-13 P06241 P06241
URS00004449AE_9606-14 P10145 P10145
URS00004449AE_9606-1 P10145 P10145
URS00004449AE_9606-15 P13726 P13726
URS00004449AE_9606-2 P13726 P13726
URS00004449AE_9606-3 P15692 P15692
URS00004449AE_9606-16 P15692 P15692
URS00004449AE_9606-18 P38936 P38936
URS00004449AE_9606-12 P38936 P38936
URS00004449AE_9606-17 P38936 P38936
URS00004449AE_9606-4 P38936 P38936
URS00004449AE_9606-19 P40763 P40763
URS00004449AE_9606-5 P40763 P40763
URS00004449AE_9606-20 P54764 P54764
URS00004449AE_9606-6 P54764 P54764
URS00004449AE_9606-7 Q8NFP9 Q8NFP9
URS00004449AE_9606-21 Q8NFP9 Q8NFP9
URS00004449AE_9606-8 Q92831 Q92831
URS00004449AE_9606-22 Q92831 Q92831
URS00004449AE_9606-23 Q92886 Q92886
URS00004449AE_9606-9 Q92886 Q92886
URS00004449AE_9606-10 Q9HB63 Q9HB63
URS00004449AE_9606-24 Q9HB63 Q9HB63
URS00004449AE_9606-11 Q9NZV1 Q9NZV1
URS00004449AE_9606-25 Q9NZV1 Q9NZV1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAAGUGCUGACAGUGCAGAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-106b
    2. Bos taurus (cattle) bta-miR-106b
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-106b
    4. Canis lupus familiaris (dog) cfa-miR-106b
    5. Capra hircus chi-miR-106b-5p
    6. Equus caballus eca-miR-106b
    7. Gorilla gorilla (western gorilla) ggo-miR-106b
    8. Lagothrix lagotricha (brown woolly monkey) lla-miR-106b
    9. Macaca mulatta mml-miR-106b-5p
    10. Macaca nemestrina mne-miR-106b
    11. Mus musculus mmu-miR-106b-5p
    12. Ovis aries (sheep) oar-miR-106b
    13. Pan paniscus ppa-miR-106b
    14. Pan troglodytes (chimpanzee) ptr-miR-106b
    15. Pongo pygmaeus ppy-miR-106b
    16. Rattus norvegicus rno-miR-106b-5p
    17. Saguinus labiatus sla-miR-106b