Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-217-5p URS000041E210_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-217: Hsa-mir-217 is a microRNA that has been studied in relation to pancreatic ductal epithelium and heart fibrosis [PMC5441032] [PMC6406975]. In pancreatic ductal epithelium, the expression of hsa-mir-217 did not show a significant difference between PanIN1 and normal pancreatic ductal epithelium (NPDE) (P=0.159), but there was a significant decline in expression between PanIN1 and PanIN2 (P=0.028), as well as between PanIN2 and PanIN3 (P=0.011) [PMC5441032]. This suggests that hsa-mir-217 may play a role in the progression of pancreatic intraepithelial neoplasia (PanIN) [PMC5441032]. In the context of heart fibrosis, high expression of hsa-mir-217 in pathological rat cardiac myocytes (CMs) was found to promote its release through extracellular vesicles (EXOs). These EXOs were taken up by cardiac fibroblasts (CFs), leading to their proliferation and activation, ultimately contributing to heart fibrosis [PMC6406975]. This suggests that hsa-mir-217 may be involved in the pathological processes leading to cardiac fibrosis [PMC6406975]. Overall, these studies highlight the potential role of hsa-mir-217 in both pancreatic neoplasia and heart fibrosis [PMC5441032] [PMC6406975].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUGCAUCAGGAACUGAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-217-v1_5p (mature (guide))
  2. Bos taurus Bta-Mir-217-v1_5p (mature (guide))
  3. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-217-5p
  4. Branchiostoma floridae (Florida lancelet) bfl-miR-217
  5. Callorhinchus milii Cmi-Mir-217_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-217-v1_5p (mature (guide))
  7. Capra hircus (goat) chi-miR-217-5p
  8. Cavia porcellus (domestic guinea pig) Cpo-Mir-217-v1_5p (mature (guide))
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-217-v1_5p (mature (guide))
  10. Columba livia Cli-Mir-217-v1_5p (mature (guide))
  11. Cricetulus griseus cgr-miR-217
  12. Cyprinus carpio (common carp) ccr-miR-217
  13. Danio rerio Dre-Mir-217-v1_5p (mature (guide))
  14. Dasypus novemcinctus Dno-Mir-217-v1_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-217
  16. Gallus gallus (chicken) Gga-Mir-217-v1_5p (mature (guide))
  17. Gekko japonicus Gja-Mir-217-v1_5p (mature (guide))
  18. Latimeria chalumnae Lch-Mir-217_5p (mature (guide))
  19. Lepisosteus oculatus Loc-Mir-217_5p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) mml-miR-217
  21. Microcaecilia unicolor Mun-Mir-217-v1_5p (mature (guide))
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-217_5p (mature (guide))
  23. Ornithorhynchus anatinus (platypus) oan-miR-217-5p
  24. Oryctolagus cuniculus (rabbit) Ocu-Mir-217-v1_5p (mature (guide))
  25. Pan troglodytes (chimpanzee) ptr-miR-217
  26. Petromyzon marinus pma-miR-217a
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-217
  28. Python bivittatus Pbv-Mir-217-v1_5p (mature (guide))
  29. Sarcophilus harrisii Sha-Mir-217-v1_5p (mature (guide))
  30. Scyliorhinus torazame Sto-Mir-217-v1_5p (mature (guide))
  31. Sphenodon punctatus (tuatara) Spt-Mir-217_5p (mature (guide))
  32. Taeniopygia guttata Tgu-Mir-217-v1_5p (mature (guide))
  33. Xenopus laevis (African clawed frog) Xla-Mir-217-P3-v1_5p (mature (guide))
  34. Xenopus tropicalis Xtr-Mir-217-v1_5p (mature (guide))
Publications